1 / Os.26972.1.S1_at / LOC_Os09g38960 / Os09g0563200 / TTTGCCCTTTATTCACTGCTT / 101
TATGTGCGGCGACTGTATGTT
2 / Os.22122.1.S1_at / LOC_Os11g04954 / Os11g0146800 / ACATCAGGTGGAATAATG / 191
AGGTATAATCGTCTGGAT
3 / OsAffx.20357.1.S1_at / LOC_Os09g32930 / Os09g0506800 / AGTTCAGTGAGGGTTCGTG / 196
TAGCGTCTATCTCCATTTGC
4 / Os.56267.1.S1_at / LOC_Os06g15480 / Os06g0265400 / CCAAAGGGCAAGACAGCA / 232
GCGGAACACCTGGTCGTAG
5 / Os.52555.1.S1_at / LOC_Os06g46920 / Os06g0683100 / AGACGGAGCAAGCGGATGG / 103
GCAGGTTTGAAAGGAGGGTAG
6 / Os.40026.1.S1_at / LOC_Os03g58600 / Os03g0800200 / AAGGAGAGAGTTCGGATGGT / 143
CCAACAATCTCCTCAGCAGT
7 / Os.10061.1.S1_at / LOC_Os07g39470 / Os07g0583600 / GTGAACGCCACCATCAGGACG / 125
TAGTGCCACGCCGACGAGACCA
8 / Os.18773.1.S1_at / LOC_Os03g62180 / Os03g0838100 / AAGGAGGAATGGGCGGTTTGC / 237
GGAGAAGTAGCCGTAGTGGTTGT
9 / Os.14122.1.S1_at / LOC_Os01g21160 / Os01g0314100 / GGCATCTAGCAAAGCAGTA / 200
ATAAGAGTTAGCATCGGGTA
10 / Os.10814.1.S1_a_at / LOC_Os06g03770 / Os06g0128300 / GGTGCTCTGACTGTCGGTGAT / 204
AATGCGTCCTCCCTTGAACTG
11 / Os.49681.1.S1_at / LOC_Os03g07140 / Os03g0167600 / TCACAAGGCAGGAAGGAA / 202
GGCGACACGGGATAGGTT
12 / Os.15557.1.S1_at / LOC_Os01g31690 / Os01g0501800 / GTGCCGTTCCTCTTCACCAT / 149
GCCACAGCGTTGTCGTAGCC
13 / Os.7368.1.S1_at / LOC_Os02g42314 / Os02g0634800 / CAAGATGATCTGCCGCAAATGC / 148
TTTAACCAGTCCATGAACCCG
Supplementary Table S1. qRT-PCR gene-specific primers used in the present study
SupplementaryTable S2.Comparison of anther and microsporangium width between diploid and autotetraploid rice
Traits / Taichung 65-2x / Taichung 65-4xAnther width(µm)
Tetrad stage / 105.83±16.84 / 141.99±16.62**
Middle microspore stage / 119.13±3.48 / 148.27±6.62**
Late microspore stage / 127.52±9.06 / 161.22±8.65**
Microsporangium width(µm)
Tetrad stage / 80.70±19.35 / 91.20±27.72**
Middle microspore stage / 86.49±4.71 / 112.70±9.84**
Late microspore stage / 95.63±13.91 / 127.29±14.87**
*,** Significantly different from zero at P＜0.05 and P＜0.01, respectively.
.
Supplementary Table S3.Names and functions of some important genes found in the Gene Ontology (GO) analysis fromdown-regulated genes duringmeiosis
GO term / Gene Symbol / Gene ID / DescriptionDNA-dependent DNA replication (GO:0006261) / Os02g0797400 / LOC_Os02g55410.1 / MINI-CHROMOSOME MAINTENANCE PROTEIN 5.
Os05g0358200 / LOC_Os05g29010.1 / Similar to DNA primase, Os05t0358200-01, POLA4 - Putative DNA polymerase alpha complex subunit
Os05g0476200 / LOC_Os05g39850.1 / MINI-CHROMOSOME MAINTENANCE PROTEIN 3, MCM3 - Putative minichromosome maintenance MCM complex subunit 3
Os11g0484300 / LOC_Os11g29380.1 / MINI-CHROMOSOME MAINTENANCE PROTEIN 2, MCM2 - Putative minichromosome maintenance MCM complex subunit 2
DNA binding
(GO: 0003677) / Os01g0211800 / LOC_Os01g11350.1 / b-ZIP transcription factor 2
Os01g0733200 / LOC_Os01g53220.1 / Similar to Heat shock transcription factor 29
Os02g0739700 / LOC_Os02g50630.1 / E2F Family domain containing protein
Os02g0797400 / LOC_Os02g55410.1
LOC_Os02g55410.2 / MINI-CHROMOSOME MAINTENANCE PROTEIN 5
Os02g0829100 / LOC_Os02g58220.1 / Replication protein A 30kDa
Os03g0214100 / LOC_Os03g11540.1 / Replication protein A1
Os04g0177300 / LOC_Os04g09800.1 / HIP116, Rad5p N-terminal domain containing protein
Os05g0476200 / LOC_Os05g39850.1 / Similar to DNA replication licensing factor MCM3 homolog
Os06g0265400 / LOC_Os06g15480.1
LOC_Os06g15480.2 / Similar to Transcription factor HBP-1b(C38)
Os10g0402200 / LOC_Os10g26280.1 / Origin recognition complex subunit 3, N-terminal domain containing protein
Os11g0484300 / LOC_Os11g29380.1 / MINI-CHROMOSOME MAINTENANCE PROTEIN 2
Supplementary Table S4. List of genes and microarray data during pre-meiotic interphase (PMA), meiotic (MA) and single microspore stage (SCP)
Affymetrix probe set ID / Gene identifier (Locus) / Gene Symbol / Microarray (signal ratio)PMA / MA / SCP
Os.26972.1.S1_at / LOC_Os09g38960 / Os09g0563200 / 2.40* / 2.42 / 1.60
Os.22122.1.S1_at / LOC_Os11g04954 / Os11g0146800 / 1.55 / 0.51 / 0.43**
OsAffx.20357.1.S1_at / LOC_Os09g32930 / Os09g0506800*** / 1.09 / 0.38 / 0.53
Os.56267.1.S1_at / LOC_Os06g15480 / Os06g0265400 / 0.40 / 0.23 / 2.19
Os.52555.1.S1_at / LOC_Os06g46920 / Os06g0683100 / 4.64 / 5.73 / 0.49
Os.40026.1.S1_at / LOC_Os03g58600 / Os03g0800200 / 1.77 / 0.79 / 2.02
Os.10061.1.S1_at / LOC_Os07g39470 / Os07g0583600 / 0.25 / 0.37 / 0.20
Os.18773.1.S1_at / LOC_Os03g62180 / Os03g0838100 / 4.55 / 4.00 / 2.88
Os.14122.1.S1_at / LOC_Os01g21160 / Os01g0314100 / 2.40 / 2.42 / 1.60
Os.10814.1.S1_a_at / LOC_Os06g03770 / Os06g0128300 / 1.95 / 3.23 / 1.78
Os.49681.1.S1_at / LOC_Os03g07140 / Os03g0167600 / 1.00 / 6.03 / 1.18
Os.15557.1.S1_at / LOC_Os01g31690 / Os01g0501800 / 0.84 / 0.98 / 0.72
Note: * the ratio values (>2.0) areshowing up-regulatedgenes
** the ratio values (<0.5) are showing down-regulated genes.
*** Os09g0506800 is aPAIR2 gene(homolog of ASY1gene).
A B
Sup Fig. 1 Flow cytometry analysis showed that DNA content of autotetraploid is two-fold higher than diploid rice
A: Diploid rice, Taichung 65-2x; B: Autotetraploid rice, Taichung 65-4x
Sup Fig. 2 Cytological observation of pollen development in diploid (Taichung65-2x) and autotetraploid rice (Taichung65-4x) by WE-CLSM (whole-mount eosin B-staining confocallaser scanning microscopy)
A, C and E: Diploid rice, Taichung 65-2x. A: Tetrad; C: Middlemicrospore stage; E: Late microspore stage
B,D and F: Autotetraploid rice, Taichung 65-4x. B: Tetrad; D: Middlemicrospore stage; F: Late microspore stage
Sup Fig. 3 Hierarchical clustering of 18 arrays data atthree pollen development stages.
A: A tree image of the gene expression at various meiotic stages. Different polyploidy level rice and three developmental stages of pollen are indicated by color bars; B: Scatter plotof pre-meiotic interphase (PMA) stage; C:Scatter plot of meiotic (MA) stage; D: Scatter plot of single microspore stage (SCP).
Sup Fig. 4PAGE analysis resultsof three stages, including: pre-meiotic interphase (PMA), meiotic (MA) and single microspore stage (SCP)
Sup Fig. 5 GOanalysis results of biological process based on differentially expressed up-regulated genes in meiosis
Sup Fig. 6 GOanalysis results of cellular componentsbased on differentially expressed up-regulated genes in meiosis
Sup Fig. 7 GOanalysis results of molecular functionbased on differentially expressed up-regulated genes in meiosis
Sup Fig. 8 GO analysis results of biological processesbased on differentially expressed down-regulated genes in meiosis
Sup Fig. 9 GOanalysis results of molecular functionsbased on differentially expressed down-regulated genes in meiosis
Sup Fig. 10 GOanalysis results of biological processesbased on differentially expressed down-regulated genes in three stages, including: pre-meiotic interphase (PMA), meiotic (MA) and single microspore stage (SCP)
Sup Fig. 11 GO analysis results of cellular componentbased on differentially expressed down-regulated genes in three stages, including: pre-meiotic interphase (PMA), meiotic (MA) and single microspore stage (SCP)
Sup Fig. 12 GOanalysis results of molecular functionsbased on differentially expressed down-regulated genes in three stages, including: pre-meiotic interphase (PMA), meiotic (MA) and single microspore stage (SCP)