Supplementary Methods

Genetic screen for Ras-induced senescence bypass. A genetic suppressor element (GSE) cDNA library was prepared from heat-fragmented polyA+ RNA isolated from Rat1 cells using random priming essentially as described. The reverse transcription primer 5'-gcggaattc nnnnnnnn-3' was utilized with Gibco Superscript kit. Double strand cDNAs were blunt ended, ligated to commercial XhoI adaptors, digested with EcoRI and subcloned into EcoRI/XhoI digested modified pBABEpuro retroviral backbone. The resultant library was electroporated into DH10 cells, colonies (0.8X106 independent clones) were pooled and DNA isolated by CsCl gradient purification.

Cell lines and growth conditions. U2OS, PA-1 and WI38 cells were obtained from ATCC and normal rat embryo fibroblasts from Clonetics. The human fibroblast WI38 cells were immortalized by retroviral infection with pWZLhygro-hTERT, and the established WI38-TERT cells were used for further experiments. All cells were grown in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Sigma), and 1% antibiotic/antimycotic solution (Invitrogen). After selection, the subclones were isolated when needed.

Immunoprecipitation and Western blot (Supplement). Cells were treated with H2O2 (0.5 mM), UV (4 mJ/cm2) or g-irradiation (20 Gy), collected after designated time and lysed in buffer (50mM Tris pH8.0, 250mM NaCl, 0.5% NP-40, 10ug/ml leupeptin, 10ug/ml aprotinin, 1mM Na3VO4 and 1mM NaF). The Ras-transduced cells (with or without treatment by 10mM NAC for 4 days) were collected 10 days after infection. For immunoprecipitation, the cell lysates were pre-cleared with Protein G Plus/Protein A agarose (Oncogene) for 1 hour, then incubated with anti-Seladin-1 overnight at 4oC, followed by 2 hours binding with Protein G Plus/Protein A agarose. The precipitates were washed, incubated in Laemmli sample buffer with only 0.5% b-ME at 37oC for two min and then subjected to Western blot. An equal amount of protein (determined by BIO-RAD protein assay) from each sample was separated on SDS-PAGE gels, transferred to Protran membrane (Schleicher & Schuell Biosciences), and blotted following standard procedures. The primary antibodies used included: rabbit polyclonal anti-Seladin-1 (raised against peptide corresponding to C-terminal residues 505-516 and affinity-purified); anti-p53 (Ab-1 or Ab-6, Oncogene); anti-p21WAF1 (Ab-1 or Ab-6, Oncogene); anti-H-Ras (C-20, sc-520, Santa Cruz); anti-pan-Ras (Ab-3, Oncogene); anti-p16INK4a (C-20, sc-468, Santa Cruz); anti-p14ARF (FL-132, sc-8340, Santa Cruz); anti-Mdm2 (SPM-14 or D-12, Santa Cruz); anti-GAPDH (MAB374, Chemicon, used as a loading control). The polyclonal antibodies were blotted with HRP-linked protein A (Amersham); the monoclonal antibodies were blotted with peroxidase-conjugated rabbit anti-mouse IgG (Jackson ImmunoResearch Laboratories), followed by detection with ECL reagent (Amersham) or SuperSignal West Pico reagent (Pierce) according to manufacturers’ recommendations.

Immunostaining of Seladin-1. The cells were cultured on cover slips overnight, washed, fixed with 1% formalin and permeabilized with 0.1% NP40. After incubation with the affinity-purified anti-Seladin-1 antibody, rhodamine-conjugated goat anti-rabbit IgG (Jackson Immunoresearch Laboratories) was utilized as a secondary antibody. Cells were mounted with a mounting medium containing DAPI (Vectorshield) and examined under an Olympus IX70 microscope with a fluorescence attachment. For confocal imaging, the Alexa488-conjugated goat anti-rabbit IgG (Molecular Probes) was substituted for rhodamine-conjugated antibody, and cells were incubated in PBS with 10 ug/ml RNase and 25ug/ml propidium iodide at 37ºC for 30 min, washed, mounted with mounting medium without DAPI (Vectorshield), and examined under a confocal microscope (Zeiss Axiovert 100M).

Anchorage-independent cell growth and tumorigenesis. 0.5% low-melting agarose in DMEM (supplemented with 10% FBS and antibiotics-antimycotics) was poured into 60mm culture dishes (3 ml/dish), solidified in a cold room and then thermo-balanced at 37ºC for 1 hour. 0.3% low-melting agarose in DMEM (supplemented as above) (4 ml/dish) were mixed with 3X105 cells and poured to the top of the pre-made bottom layer. The plates were refrigerated for 15 min to solidify the top layer, and then incubated at 37ºC. Fresh top layer agarose medium (1ml/dish) was added once a week during growth. For in vivo tumorigenesis, 2-3x106 cells were injected into the flanks of nude mice. The animals were observed every 3 days and were sacrificed after their tumours reached 5-10 mm.

Construction and utilization of Seladin-1 mutants. To make the various Seladin-1/DHCR24 mutants, mutagenizing primers were synthesized and used with a QuickChange II XL site-directed mutagenesis kit following the instructions (Stratagene). The wild type Seladin-1 template was pcDNA3-Seladin-1. The coding strand primer sequences were: N294T5’ GAGCCCAGCAAGCTGACTAGCATTGGCAATTAC3’;K306N 5’GCCGTGGTTCTTTAACCATGTGGAGAACTATCTG3’; S419N 5’CGTTCATCCTGCCCAACCAGCCC AGGCCTAG3’; L210Q 5’CCGAAAACTCAGACCAGTTCTATGCCGTACC3’; F211S5’CGAAAACTCAG ACCTGTCCTATGCCGTACCCTG3’; DM(deletion of aa 358-421) 5’CTACCTCTTTGGCTGGGGCCTAG TGCACCC. For making a double mutant (N294T, K306N), N294T Seladin-1 mutant was used as a template for a second round of mutagenesis with the K306N primers. The FLAG epitopes were added to the C-terminal of each Seladin-1 variant by PCR with the following primers: N-BamHI 5’ CGGGATCCGCACCATGGAGCCCGCCGTG3’ and C-FLAGEcoRI 5’CCGGAATTCTTCAGCCCTTGTCATCGTCGTCCTTGTAGTCGTGCCTGGCGGCCT TGC 3’. Each Seladin-1 variant was sub-cloned into pBABEpuro and pWZLneo (BamHI-EcoRI sites) for stable retroviral transduction. For creating the FLAG-p53 mutants, the appropriate human p53 mutant cDNAs were subjected to PCR with N-terminal FLAG primers and resultant molecules were subcloned into pcDNA3. For immunoprecipitation of FLAG epitope-tagged Seladin-1 or FLAG-p53 variants, the FLAG immunoprecipitation kit was used according to the instructions (Sigma). On Western blots, FLAG-tagged proteins were detected with monoclonal anti-FLAG M2 antibody (Sigma).

Recombinant protein expression, purification and ubiquitination assays. The human Mdm2 (Hdm2) and Seladin-1 DNAs were subcloned into pGEX-KG. FLAG-p53 was created by adding FLAG-epitope sequences to N-terminus of human p53, followed by subcloning into PET11a vector (Novagen). All plasmids were introduced into BL21(DE3) or Rosetta pLysS cells, proteins were induced with the IPTG at room temperature overnight. The proteins were purified from bacterial cell extracts prepared by sonication on Glutathione agarose (Pharmacia) or anti-FLAG monoclonal antibody (M2)-agarose beads (Sigma). In some cases, GST-Mdm2 was digested with thrombin, followed by FPLC to yield purified Mdm2. The ubiquitination assays were done essentially as described (Li et al., 2003), with the final DTT concentration at 0.2 mM. Ubiquitin conjugating E1, E2 (ubc5a) and His-Ubiquitin were from Boston Biochem., Inc.

For the experiments described in Fig. 4c, 100ng of FLAG-p53 (bound to approximately 10 ml of M2-agarose beads, Sigma) were incubated with 0, 10, 40 or 200 ng of GST-Seladin-1 or same amount of GST in 20 ml binding buffer (25mM TrisHCl, 150 mM NaCl, 0.2 mM PMSF, pH 7.6, containing 2 mg/ml of bovine serum albumin (BSA) as carrier). Incubation continued for 30 min on ice, followed by the addition of 100 ng of Mdm2 and another 30 min period of incubation. Duplicate samples were ether incubated directly with equal volume of 2x Laemmli sample buffer (for input) or agarose beads were recovered by centrifugation, washed thrice with binding buffer supplemented with 0.1% NP-40 to remove Seladin-1 and/or Mdm2 that did not attach to p53, and then denatured with equal volume of 2XLaemmli sample buffer. Samples were separated on 10% PAGE and subjected to immunoblot with anti-Mdm2, anti-p53 or anti-Seladin-1 antibody as indicated.

For experiments described in Fig. 4d, 10 ng of FLAG-p53 were incubated in 20ml reaction with 200 ng GST-Seladin-1 or GST for 30 min on ice, followed by the assembly of the ubiquitination reaction containing 7-10mg His-Ubiquitin, 10ng of E2 (ubc5a), 1 ng E1 in 25mM TrisHCl, pH 7.6, 5mM MgCl2, 2mM ATP, 0.2mM DTT with the addition of variable amounts of Mdm2 as E3 (5, 20,100 ng). Reactions with no Mdm2 or no ubiquitin added served as controls. The reactions continued for 30-60 min at 37oC and were stopped by equal volume of 2XLaemmli sample buffer.

Supplementary DATA

Genetic screen. The library DNA was converted into recombinant retrovirus (107 infectious units) as described in Methods and transduced into approximately 5X106 primary rat embryo fibroblasts grown at passage 2-3. The cells were selected with puromycin and surviving cells were re-transduced with H-rasVal12 expressing pWZLhygro retrovirus followed by selection with hygromycin. One week to ten days later, among cells transduced with GSE library and Ras-expressing retrovirus we observed thirty colonies in total displaying “transformed” cellular phenotype upon microscopic examination. Among control cells transduced with empty pBABEpuro and Ras retrovirus a single “transformed’ colony was observed, probably corresponding to a rare somatic mutation in culture that facilitated further transformation by Ras. No “transformed” colonies were observed on plates with cells transduced with the GSE expressing library and empty pWZLhygro retrovirus. Of the original thirty independent colonies that were recovered, we were able to isolate inserts from the genomic DNA by long range PCR using primers corresponding to vector sequences in 14 independent clones. Three of those were sequences not present in the current rat databases, and six were rearranged clones with PCR products corresponding to vector sequences. Finally, five independent clones contained GSE inserts corresponding to a C-terminal region of the single rat gene, a putative oxidoreductase Seladin-1/hDiminuto/DHCR24 (Supplementary Fig.1).

The full-length human Seladin-1 cDNA (4.2 kb) was isolated by low stringency hybridization of a human teratocarcinoma cDNA library with one of the isolated rat GSE sequence (R1-4). The Seladin-1 cDNA sequence includes an open reading frame (ORF) predicted to encode a 516 amino acid protein with a calculated molecular weight of 60.1kDa that is identical to previously described Seladin-1 sequence. Seladin-1 is also an alias of later HUGO entry DHCR24. The Northern blot analysis of RNA from adult mouse tissues identified a single mSeladin-1 mRNA transcript (4.2-4.4kb; Fig. 1b).

Human cells expressing Ras. Normal human fibroblasts (WI38) were transduced with hTERT-expressing retrovirus, and the resultant immortalized WI38-TERT cells were grown as a cell population without any additional clonal selection and used in subsequent experiments described in the main text. Upon Seladin-1 knockdown by siRNA (described in the main text) and to maximize the potential effect of Seladin-1/DHCR24 inhibition, several clones with at least 90% reduction in Seladin-1/DHCR24 level (Fig. 1e) were selected and expanded in culture. Oncogenic Ha-RasV12 was transduced into these cells by retroviral infection (WZLneo Ha-RasV12). As a result cells, co-expressing Seladin-1 siRNA and Ras failed to senesce at any time point during prolonged culturing. Control cells were induced to undergo senescence by Ras in 7-10 days, which was again reflected by the enlarged and flattened cell morphology and positive SA-b-Gal staining (Fig. 1e, right panel and 1f, upper right panel). Moreover, the proliferating cells (pBABEpuro-Seladin-1si/pWZLneo-Ras) gained anchorage-independent growth ability. They proliferated in soft agarose medium and formed foci in 3 weeks (Fig. 1f, middle lower panel) that were comparable both in size and number to those formed by human osteosarcoma cells (U2OS), suggesting that these cells have been transformed to achieve anchorage independent growth (Supplementary Methods).

Mutagenesis and oxidative stress. We prepared novel (L2110Q, F211S), S419N and DM (aa 358-421) Seladin-1 mutants and N294T, K306N Seladin-1 mutant previously described as defective in 3-beta-hydroxysterol D24-reductase (DHCR24) activity in a patient with desmosterolosis (Waterham, Koster et al. 2001). Wild type and mutant Seladin-1 proteins modified with a C-terminal FLAG-epitope were transiently expressed in human PA-1 cells known to also express wild type p53, p16INK4a and p14ARF. FLAG epitope-tagged protein complexes from control and hydrogen peroxide treated transfected cells were retained on anti-FLAG-IgG agarose beads and immunoblotted with anti-FLAG or anti-p53 antibodies. All Seladin-1 proteins were expressed similarly, but both S419N and DM mutants of Seladin-1 show significantly reduced interaction with p53 (Fig. 2c and 4b). In contrast, N294T, K306N Seladin-1 mutant retained significant p53 binding (Fig. 2c).

To ascertain whether any of the Seladin-1 missense mutants were able to function in a dominant-negative fashion in cells expressing wild type Seladin-1, we introduced them into WI38-TERT cells using retroviral constructs and assayed p53 response to oxidative stress. As the result, we found that expression of S419N Seladin-1 mutant interfered with theinduction of p53 while N294T, K306N had no such effect (Supplementary Fig. 4, top panel), suggesting a dominant negative function of S419N Seladin-1 mutant in p53 response to oxidative stress. Since S419N Seladin-1 mutant showed little or no p53 binding, the interference was most likely upstream of p53. Finally, stable reconstruction of the wild type Seladin-1 expression in Seladin-1si-WI38-TERT cells resulted in a recovery of p53 response to oxidative stress (Supplementary Fig. 4, bottom panel). Interestingly, expression of N294T, K306 Seladin-1 mutant lacking DHCR24 activity produced results similar to the wild type protein and no p53 response was observed in S419N Seladin-1 expressing Seladin-1si-WI38-TERT cells (Supplementary Fig. 4, bottom panel).

SUPPLEMENTARY FIGURES

Supplementary Figure 1 Illustration of human Seladin-1 cDNA, siRNA and relative position of rat GSE sequences. Rat GSE sequences (antisense) isolated in the screen described above are shown as arrows. Sequence of one rat GSE, R1-4, is shown. ATG-initiator codon, STOP-stop codon. Position of various sequences are shown in numbers corresponding to or equivalent to the human Seladin-1 cDNA with GeneBank accession # AF261758.

Supplementary Figure 2 Co-immunoprecipitation of Seladin-1 and p53 in Ras transduced cells.

Extracts from control WI38-TERT, transduced with vector control or WI38-TERT cells transduced with Ras expressing retrovirus were immunoprecipitated with anti-Seladin-1 antibodies and subjected to Western Blot with anti-p53 antibodies (Ab-6, Oncogene Research).

Supplementary Figure 3 Seladin-1 in cytoplasmic and nuclear fractions.

Western blot analysis of Seladin-1 in cytoplasmic (C) and nuclear fractions (N) in WI38-TERT cells before (-) and after (+) H2O2 (0.5mM) treatment. WI38-TERT cells fractionation was done as described (Nikolaev, Li et al. 2003) in control cells or eight hours after H2O2 treatment. The resultant fractions were immunoblotted with anti-Seladin-1 and anti-GAPDH antibodies. GAPDH is known to be exclusively cytoplasmic.

Supplementary Figure 4 Effect of Seladin-1 mutants on oxidative stress response.

Wild type or mutant Seladin-1 was expressed using retroviral vectors pBabepuro in WI38-TERT (top panel) or pWZLneo in Seladin-1siWI38-TERT cells (bottom panel). Cells were subjected to oxidative stress (0.5 mM H2O2, 12hr) and whole cell extracts were immunoblotted with either anti-p53 or anti-FLAG antibodies as indicated. GAPDH antibody was used for loading control.

Supplementary Figure 5 Alignment of human, mouse, rat and soil nematode C. elegans Seladin-1 orthologs. Box shading of ClustalW alignment of relevant proteins was performed using Boxshade server at http://www.ch.embnet.org/software/BOX_form.html.  -mutations inactivating DHCR24 activity in patient with desmosterolysis,  - L210Q,F211S (this study),  -S419N, affecting p53 function. Predicted FAD-binding domain is underlined, P-box and M-box are shown.