DNA and Replication
Part A:
- What is the function of DNA in cells?
Storage of code or blueprint for making the organism.
- Describe the components and structure of a DNA nucleotide.
Made of 4 different nucleotides: Adenine, Thymine, Cytosine, Guanine. Nucleotides are arranged with alternating sugars and phosphates where the sugar of one nucleotide is attached to the phosphate of the next nucleotide. The nitrogenous base of each then extends into the center of the double stranded molecule to hydrogen bond with a complimentary base on the anti parallel strand.
- List the names and abbreviations of the 4 bases
A – adenine; C – cytosine; G – guanine; T - Thymine
- Why is DNA called a double helix?
Made of two antiparallel strands which coil into a helix.
- What forms the sides of the DNA ladder?
Alternating sugar s and phosphates
- What forms the rungs of the DNA ladder?
Hydrogen bonded nitrogenous bases
- Where and in what form is eukaryotic DNA found?
In the nucleus, as chromatin
Part B:
- What is meant by the term base-pairing? How is base-paring involved in DNA replication?
A is always paired with T and C is always paired with G. A complimentary strand may be synthesized by using the base pairing rules to match bases with the template.
- Explain how DNA is replicated. In your explanation, state the role of DNA polymerase and explain why the replication process is considered semi-conservative.
Helicase unzips DNA. Single stranded binding proteins keep DNA unzipped. Primase adds RNA primers so that DNA polymerase may begin at origin of replication, synthesizing the new strands from 5’ to 3’. The leading strand is synthesized following the continuously expanding replication fork. Lagging strand requires the creation of Okazaki fragments as DNA polymerase must leapfrog back into the replication fork and synthesize the new strand from 5’ to 3’ going away from the fork.
New double stranded DNA contains one old parent strand and one new daughter strand – making it semi conserved.
- A cell containing a single chromosome undergoes two replications. Starting with the original DNA molecule as one color and the newly synthesized DNA as another color. Sketch the DNA molecules after one replication followed by a second replication. How does your sketch show the synthesis of DNA as being semi-conservative?
(See diagram in lecture
- The base sequence of the template strand of DNA is CTACGCTAGGCGATTGAACT. What is the new synthesized complementary strand?
CTACGCTAGGCGATTGAACT
GATGCGATCCGCTAACTTGA