Supplementary Table 1. Chromatographic gradient conditions for the HPLC analysis of phytohormones

IAA and NAA（detection wavelength 280nm） / Zeatin and BA（detection wavelength 267nm）
Time（min） / Methanol(%) / Water with 0.5% acetic acid (%) / Flow(ml/min) / Time（min） / Methanol(%) / Water（%） / Flow(ml/min)
0 / 3 / 97 / 1 / 0 / 3 / 97 / 1
60 / 67.7 / 32.3 / 1 / 38 / 63.6 / 36.4 / 1
61 / 100 / 0 / 1 / 39 / 100 / 0 / 1
71 / 100 / 0 / 1 / 49 / 100 / 0 / 1
72 / 3 / 97 / 1 / 50 / 3 / 97 / 1
80 / 3 / 97 / 1 / 60 / 3 / 97 / 1

Supplementary Table 2. Regression equations and linear calibration ranges of phytohormone

Phytohormones / Y=aX(ng)+b / R2 / Calibration range (ng)
IAA / Y=2068.3X-45962 / 0.9966 / 50-1000
NAA / Y=2593.5X-37611 / 0.9956 / 50-1000
Z / Y=2928.3X+54630 / 0.9982 / 50-1000
BA / Y=5275.5X+28600 / 1.0000 / 50-1000

Supplementary Table 3. Primer sequences for the quantification of transcripts by RT-PCR

Gene name / Forward primer / Reverse primer
MdPIN1 / CGTTTACGGGATGTCTGCG / GCTTGCCCATTAGCCCTCTTT
MdPIN2 / CCAAGCCCCAAACACGGATAT / CAGCCCGCCACTCGTAGACC
MdPIN3 / ACGCATCAAGGCGGTCACTC / TACCGTCTGCGCGGGATAAA
MdPIN4 / AAGCTCCATGTCACTGTCAGAAAAT / CTCGGACTCGCATTGCTCAT
MdPIN5 / ATGATTGGGTGGGAAGATGTTTACA / TTATGAGCTTAGAGATGAAGTCGGC
MdPIN6 / CGAATCCGGCGCTCTACCT / TGCTGTGAAAATCTCCCCGTC
MdPIN7 / GCGGAGATTTACAGCCTGAGC / GGGAGGACTGAACCGAATACAA
MdPIN8 / ACCATAAAGTTCACCATCACC / TGTGACATTCTTGTTCTTCAAC
MdPIN9 / CGTCTCCACTCTGCCCAACACTC / CTGTCTTCCGTCGAGCGACATAAT
MdPIN10 / CTGGACCAAAGTCAGCAAAAGGG / AGCGACATAATATCGGAGTCGACGT
MdPIN11 / AGAACCACTCCAAACCGACGC / CCCCAAATCCACCTTGAAAACT
MdPIN12 / CTAAGGAATACAATGTTCATCCAA / GTTTGCTCGACATGATAAATAGA
MdPIN13 / ATGTTGGTGTCCCTTCCG / CTTTCCCCTCGATCGATC
MdLAX1 / CATTCATCGTGGTGTGGGTGC / GCGGTGGTGGGGAGGCT
MdLAX2 / CCATCCCTGGCCCACATTTTC / AGGGTGGCGGAGAGGAGGA
MdLAX3 / GATTTGGATTCGGTGGGTGG / GGTATGGGAGTGATTACGAGGCAG
MdLAX4 / ACACCGCCGCACCACTACC / GAAAACGAATACGGCAGTGTGAGAA
MdLAX5 / CGTCAGCAATGGCAGCACA / GGAGAAAGAGTAGGGCAAAGTCAG
MdLAX6 / CACCGTCTACATCATCCCATCTTTA / GCGGCTGCTAGTGGTGGTTTT
MdLAx7 / CACCGTCTACATCATCCCATCTTTA / GAGCTGCGGCTGCTAGTGG
MdLAX8 / GGTTCTGGTGATTGGGTTCGGGTTC / TGCGGCTGCTAGTGGCGGTTTT

Supplementary Table 4. Analysis of variance of MdPIN8, 10 and 13 gene expression in stem bark of Fuji/M9, Fuji/M9/Baleng Crab and Fuji/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between rows.

Material / Gene name / part
scion / interstock / rootstock
Fuji/M9 / MdPIN8 / 5.947 a / 2.922 b
MdPIN10 / 16.618 a / 5.477 b
MdPIN13 / 6.989 a / 0.727 b
Fuji/M9/Baleng Crab / MdPIN8 / 12.519 a / 3.016 b / 12.402 a
MdPIN10 / 5.936 a / 6.049 a / 4.867 a
MdPIN13 / 5.190 a / 4.350 a / 2.080 b
Fuji/Baleng Crab / MdPIN8 / 13.010 a / 13.441 a
MdPIN10 / 16.066 a / 13.108 a
MdPIN13 / 15.174 a / 15.533 a

Supplementary Table 5. Analysis of variance of MdLAX1and 8 gene expression in stem bark of Fuji/M9, Fuji/M9/Baleng Crab and Fuji/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between rows.

Material / Gene name / site
scion / interstock / rootstock
Fuji/M9 / MdLAX1 / 6.657 a / 5.780 a
MdLAX8 / 2.025 b / 4.382 b
Fuji/M9/Baleng Crab / MdLAX1 / 6.670 a / 4.546 b / 2.234c
MdLAX8 / 3.315 a / 3.655 a / 3.328 a
Fuji/Baleng Crab / MdLAX1 / 7.483 a / 6.391 a
MdLAX8 / 7.110 b / 9.466 a

Supplementary Table 6. Analysis of variance of effects of NAA foliar spraying on auxin and zeatin contents (ng/g FW), and MdPIN gene expression in Fuji/M9. Means sharing the same letter are not significantly different (P > 0.05) between lines; NS, not significantly different; and * Significantly different (P ≤ 0.05) between rows.

Detection index / Time of treatment / part
leaf / Stem bark of scion / Stem bark of rootstock / root
IAA / 0day / 195.9513 a / 127.4514 a / 134.1360 a / 93.1923 ab
1day / 133.4050 b / 63.7935 b / 51.9150 bc / 60.7472 b
2day / 104.3394 bc / 54.6798 bc / 36.6851 c / 67.2793 b
3day / 74.8236 cd / 36.9042 bc / 39.8112 c / 64.9486 b
1week / 69.4579 d / 33.6636 c / 31.5344 c / 58.4471 b
2week / 58.3764 d / 59.1968 bc / 52.1713 bc / 80.7992 ab
3week / 112.8311 b / 63.0882 b / 70.8997 b / 110.3036 ab
Z / 0day / 47.4804 bc / 51.6127 b
1day / 43.5597 c / 76.2820 ab
2day / 70.5195 a / 73.8902 ab
3day / 75.7325 a / 81.4414 a
1week / 59.5036 abc / 61.8679 ab
2week / 66.5354 ab / 53.0127 b
3week / 47.6630 bc / 55.3645 ab
MdPIN8 / 0day / 1.0286 d / 0.5581 d
1day / 7.4914 bc / 0.9790 c
2day / 8.7145 a / 1.0110 c
3day / 8.3060 ab / 1.2489 b
1week / 7.1768 c / 2.4328 a
2week / 2.0372 d / 0.5303 d
3week / 1.0538 d / 0.6162 d
MdPIN8 total / 5.1155 * / 1.0538
MdPIN10 / 0day / 1.9027 c / 0.5345 b
1day / 6.0681 a / 1.1516 a
2day / 6.8804 a / 1.0975 a
3day / 6.3580 a / 1.1957 a
1week / 4.7867 b / 1.0645 a
2week / 1.7852 c / 0.7432 b
3week / 1.0272 c / 0.6152 b
MdPIN10 total / 4.1155 * / 0.9146

Supplementary Table 7. Analysis of variance of effects of root application of NAA on auxin and zeatin contents (ng/g FW) in Fuji/M9. Means sharing the same letter are not significantly different (P > 0.05) between lines.

Detection index / Time of treatment / part
leaf / root
IAA / 0day / 172.2863 a / 91.5163 a
1day / 172.2531 a / 519.4435 a
2day / 68.3828 b / 651.3730 a
3day / 70.0362 b / 490.8261 a
1week / 90.1623 b / 497.0677 a
2week / 75.9273 b / 363.8485 a
3week / 84.0586 b / 180.3076 a
Z / 0day / 52.3459 c / 53.9117 c
1day / 72.0292 ab / 67.9676 bc
2day / 77.4730 a / 82.9845 ab
3day / 65.9931 abc / 83.3695 ab
1week / 51.9311 c / 86.0880 a
2week / 57.9594 bc / 83.6755 ab
3week / 58.9098 abc / 86.0670 a

Supplementary Table 8. Analysis of variance of effects of 6BA foliar spraying on auxin and zeatin contents (ng/g FW) in Fuji/M9. Means sharing the same letter are not significantly different (P > 0.05) between lines.

Detection index / Time of treatment / part
leaf / root
Z / 0day / 53.2995 a / 58.0204 a
1day / 55.2931 a / 64.8854 a
2day / 37.9796 b / 42.8589 b
3day / 30.5697 bc / 37.4957 b
1week / 29.6210 bc / 32.4959 bc
2week / 18.1840 c / 21.9034 c
3week / 18.8313 c / 21.5657 c
IAA / 0day / 169.5459 a / 89.8136 c
1day / 182.2230 a / 90.6163 c
2day / 186.9656 a / 93.6757 c
3day / 192.5047 a / 148.9749b
1week / 193.0755 a / 179.6763 b
2week / 194.1121 a / 222.4733 a
3week / 190.9273 a / 223.8417 a

Supplementary Table 9. Analysis of variance of effects of 6BA root application on auxin and zeatin contents (ng/g FW) in Fuji/M9. Means sharing the same letter are not significantly different (P > 0.05) between lines.

Detection index / Time of treatment / part
leaf / root
Z / 0day / 53.8119 a / 61.7965 a
1day / 39.1101 ab / 43.2286 b
2day / 33.5967 bc / 38.0465 bc
3day / 25.6383 bc / 24.7230 cd
1week / 25.6671 bc / 25.2526 cd
2week / 23.2996 bc / 24.9511 cd
3week / 19.5667 c / 20.2600 d
IAA / 0day / 172.0411 a / 91.5265 cd
1day / 177.6527 a / 92.0832 cd
2day / 169.4316 a / 111.7605 c
3day / 183.6019 a / 78.2682 d
1week / 168.4477 a / 109.1842 cd
2week / 183.9336 a / 183.6844 b
3week / 177.8512 a / 217.6517 a

Supplementary Table 10. Analysis of variance of effects of NAA foliar spraying on auxin, zeatin contents (ng/g FW) and MdPIN gene expression in Fuji/M9/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between lines; means sharing the same letter in the brackets are not significantly different between rows.

Detection index / Time of treatment / part
leaf / Stem bark
of scion / Stem bark of interstock / Stem bark of rootstock / root
IAA / 0day / 218.6565 a / 139.6750 a / 151.0189 a / 101.5154 a / 114.0190 a
1day / 159.4481 b / 61.5070 a / 78.5162 de / 48.4730 c / 62.2543 b
2day / 147.5859 b / 54.8716 bc / 57.5952 e / 35.3030 c / 65.1734 b
3day / 100.0092 c / 38.2576 c / 88.6307 cd / 33.6404 c / 71.5438 b
1week / 93.1693 c / 35.5370 c / 115.2329 b / 47.5751 c / 63.9902 b
2week / 72.6389 c / 62.6823 b / 109.1835 bc / 76.8066 b / 82.3106 b
3week / 164.7884 b / 70.6617 b / 122.5626 b / 96.4406 a / 109.7617 a
IAA total / 66.1703(b) / 103.2486(a) / 62.8220(b)
NAA / 0day / 0.0000 c / 0.0000 e / 0.0000 c / 0.0000 c / 0.0000 c
1day / 489.9621 a / 141.0273 c / 274.5885 a / 77.6630 a / 75.2210 a
2day / 542.6839 a / 178.0681 b / 251.3778 a / 86.7113 a / 64.5620 a
3day / 520.3038 a / 220.1249 a / 242.8154 a / 74.8526 a / 67.1668 a
1week / 492.7942 a / 151.8927 bc / 277.1460 a / 76.2099 a / 71.2995 a
2week / 323.6557 b / 70.8036 d / 108.9237 b / 71.5035 a / 56.8023 a
3week / 48.7421 c / 14.1546 c / 15.8736 c / 30.0211 b / 29.9669 b
NAA total / 110.8673(b) / 167.2464(a) / 59.5659(b)
NAA+IAA / 0day / 218.6565 c / 139.6750 d / 151.0189 e / 101.5154 b / 114.0190 a
1day / 649.4101 a / 202.5342 bc / 353.1047 b / 126.1359 ab / 137.4753 a
2day / 690.2698 a / 232.9397 ab / 308.9730 c / 122.0143 ab / 129.7354 a
3day / 620.3129 a / 258.3825 a / 331.4461 bc / 108.4930 b / 138.7107 a
1week / 585.9635 a / 187.4296 c / 392.3789 a / 123.7850 ab / 135.2898 a
2week / 396.2945 b / 133.4859 d / 218.1072 d / 148.3102 a / 139.1130 a
3week / 213.5305 c / 84.8164 e / 138.4362 e / 126.4617 ab / 139.7286 a
NAA+IAA total / 177.0376(b) / 270.4950(a) / 122.3879(c)
Z / 0day / 48.6314 a / 52.5931 ab
1day / 44.5831 a / 43.3102 b
2day / 51.3024 a / 62.9454 a
3day / 55.4590 a / 65.5533 a
1week / 52.1428 a / 67.0140 a
2week / 51.2389 a / 58.0613 ab
3week / 48.3501 a / 57.0580 ab
MdPIN8 / 0day / 1.0014 d / 0.2315 d / 1.0535 e
1day / 6.6161 c / 0.8736 b / 1.5925 bc
2day / 13.6554 b / 0.8692 b / 1.3299 cde
3day / 15.3324 ab / 0.9264 b / 1.6395 b
1week / 15.9455 a / 0.8119 b / 2.0660 a
2week / 1.4889 d / 1.2134 a / 1.2391 de
3week / 1.1376 d / 0.3965 c / 1.4658 bcd
MdPIN8 total / 7.8825(a) / 0.7604(b) / 1.4838(b)
MdPIN10 / 0day / 0.5300 d / 0.2434 d / 0.5351 cd
1day / 2.2185 c / 0.8775 c / 0.6024 c
2day / 6.1426 a / 1.0031 bc / 1.0978 a
3day / 6.2039 a / 0.9825 bc / 0.9955 b
1week / 3.3820 b / 1.2188 ab / 0.6235 c
2week / 1.1515 d / 1.4187 a / 0.4840 d
3week / 0.5316 d / 0.1853 d / 0.9956 b
MdPIN10 total / 2.8800(a) / 0.8470(b) / 0.7620(b)

Supplementary Table 11. Analysis of variance of effects of NAA root application on auxin and zeatin contents (ng/g FW) in Fuji/M9/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between lines.

Detection index / Time of treatment / part
leaf / root
IAA / 0day / 204.7031 a / 99.0144 a
1day / 195.3531 a / 94.5479 ab
2day / 84.3692 bc / 69.3944 ab
3day / 73.4785 c / 61.7766 b
1week / 99.3929 bc / 73.6678 ab
2week / 102.9120 bc / 79.9451 ab
3week / 113.5253 b / 91.9660 ab
Z / 0day / 53.9117 b / 57.4586 c
1day / 67.9676 b / 73.5594 c
2day / 88.2649 a / 108.2057 b
3day / 98.4562 a / 125.9003 ab
1week / 101.1748 a / 142.4478 a
2week / 106.3056 a / 141.0385 a
3week / 93.6104 a / 112.1246 b

Supplementary Table 12. Analysis of variance of effects of NPA treatment on auxin and zeatin contents (ng/g FW) in Fuji/Baleng Crab. Means sharing the same letter are not significantly different (P > 0.05) between lines.

Detection index / Treatment method / Time after treatment / part
leaf / Stem bark above treatment area / Stem bark beneath treatment area / root
IAA / NPA / 0day / 471.9387 a / 229.3209 b / 230.6963 a / 233.9786 a
1day / 461.9197 a / 427.8144 a / 53.2854 b / 181.1085 b
2day / 199.1475 b / 130.6711 c / 33.3631 b / 157.2288 b
3day / 149.7278 bc / 110.8501 c / 36.8908 b / 112.9874 c
1week / 106.3102 c / 103.5039 c / 32.4313 b / 103.9432 c
2week / 83.9551 c / 89.2687 c / 44.0233 b / 109.5138 c
3week / 107.5889 c / 105.6352 c / 47.0176 b / 123.2970 c
Z / 0day / 100.84071 a / 112.00524 a
1day / 93.36732 ab / 98.43782 ab
2day / 102.90259 a / 108.42505 a
3day / 73.54382 bc / 84.63797 bc
1week / 65.29733 c / 66.96544 cd
2week / 25.53826 d / 49.38256 d
3week / 32.32311 d / 54.21114 d
IAA / lanolin / 0day / 489.5190 a / 230.4692 a / 220.7161 a / 229.4121 ab
1day / 417.7304 a / 228.5762 a / 212.3171 a / 246.4058 ab
2day / 506.4476 a / 216.4816 a / 168.2156 b / 239.3606 ab
3day / 461.4684 a / 174.0967 b / 143.6547 b / 221.9507 b
1week / 465.2333 a / 162.8843 b / 147.0717 b / 275.8259 a
2week / 450.8516 a / 142.6741 b / 141.9748 b / 261.6550 ab
3week / 429.7618 a / 175.6850 b / 137.5651 b / 232.7197 ab
Z / 0day / 99.3656 a / 112.0052 a
1day / 98.2091 a / 103.4869 a
2day / 95.9298 a / 118.3919 a
3day / 107.8855 a / 104.7002 a
1week / 101.1748 a / 107.8097 a
2week / 106.3056 a / 118.5216 a
3week / 105.4532 a / 120.3227 a

Supplementary Table 13. Analysis of variance of effects of growth regulators treatment on total length, number, and average length of new shoots in apple trees with different rootstocks. *Significantly different (P ≤ 0.05) compared to the control.

variety / Treatment method / Detection index
Total shoot length(cm) / Shoot number / Average Shoot length(cm)
Fuji/M9 / control / 137.8 / 6 / 22.5
NAA(S) / 218.05 / 7.5 / 29.7
NAA(R) / 226.65 / 9.5 / 26.3
6BA(S) / 418.1* / 11.5* / 36.9 *
6BA(R) / 422.85* / 10 / 43.3 *
Fuji/M9/Baleng Crab / control / 114.8 / 4 / 28.7
NAA(S) / 211.7* / 6.5* / 32.7
NAA(R) / 339.9* / 8* / 42.7
Fuji/Baleng Crab / control / 397.9 / 14 / 28.5
NPA / 110.3* / 6.5* / 15.8
lanolin / 388.4 / 10 / 38.9 *