SUPPLEMENTAL INFORMATION for Bo Zhang Et Al

SUPPLEMENTAL INFORMATION for Bo Zhang et al.,

“Developmental plasticity shapes synaptic phenotypes ofautism-associated neuroligin-3 mutations in the calyx of Held”

A. DETAILED EXPERIMENTAL PROCEDURES

Mice handingThefollowing mouse lines were used for breeding and for the experiments: NL3 constitutive KO1, PV-Cre2, Cre reporter mice (Jackson Laboratory, stock number: 007908), Krox-20 cre3, NL3 conditional knockout mice4, and Cbln1 conditional KO mice. All of these mice were described previously except for the Cbln1 conditional KO mice whose generation is detailed below. All physiological analyses were performed on mice of either sex whose genotype was blinded to the experimenters. Mice had free access to food and water. Investigational procedures conformed to all applicable federal rules and guidelines, including the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals, and were approved by the Stanford University and St. Jude’s Hospital Administrative Panels on Laboratory Animal Care.

Generation of floxed Cbln1 (Cbln1fl/fl) and Cbln1 KO mice (Cbln1-/-) A recombinnering approach5 was used to generate the floxed Cbln1 construct. A 15.7-kb DNA fragment containing exon 1-3 of the Cbln1 gene was isolated from a bacterial artificial chromosome (BAC) DNA (Sanger Wellcome Trust) and cloned into the PL253 vector. Two loxP sites were engineered to flank a 2.76-kb DNA region containing exon 3 that encodes the C1q motif of Cbln1. A BglII restriction site was inserted adjacent to the 5′ end of the first loxP site, whereas a neo cassette was inserted at the 5′ end of the second loxP site. Embryonic stem (ES) cells derived from the 129svev strain (Millipore) were electroporated with linearized targeting vector and selected with G418 and fialuridine (FIAU). DNA from ES cells was digested by BglII and analyzed by Southern blotting using a 0.5-kb external 5’ probe and a 1-kb 3’probe. Chimeras were used to generate founder strains. To delete Cbln1 in germ cells and generate Cbln1-/- mice, male Cbln1fl/fl mice were crossed with female mice carrying Sox2-Cre (Jackson Labs, Bar Harbor, ME). Cbln1+/− mice were further inbred to generate Cbln1−/− mice that were overtly ataxic. Genotyping was performed by Southern blotting and PCR. PCR primers were floxed Cbln1 5′ primer 5′-AGGATTGGGAAGACAATAGCAGG -3′ and floxed Cbln1 3′ primer 5′-CTTAGGAAAAGGAATGGACAGCA -3′, as well as Cbln1 wild-type 5′ primer 5′-TTTTTGTTTTTTTCTTCCCCCAC -3′ and Cbln1 wild-type 3′ primer 5′-AGTCACCCTCTCAATTCTTGCCC -3′. PCRs produced a WT band of 342 bp, floxed band of 437 bp, and KO band of 544 bp.

Quantitative RT-PCR Brainstem containing MNTB at age of P1-18 mice were carefully dissected under microscopy. RNA extraction was carried out using TRIzol reagent according to manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA) and quantified using a ND-1000 spectrophotometer (NanoDrop, ThermoScientific, Wilmington, DE, USA). To measure transcript levels of NLs, Cblns, and GluRδs, we performed qRT-PCR using the LightCycler480 Master Hydrolysis Probes Kit, RNase Inhibitor and ROX Reference Dye (Roche Diagnostics, Indianapolis, IN, USA) as previously described6. FAM-dye coupled detection assays were purchased from Integrated DNA Technologies (IDT, Coralville, IO, USA): NL1 (forward: GATGTGATGTTGAGTGCAGTAGTA, reverse: GGTTGGGTTTGGTATGGATGA, and probe TGGTGACCCAAATCAACCAGTTCCT), NL2 (forward :CCGTGTAGAAACAGCATGACC, reverse: TGCCTGTACCTCAACCTCTA and probe: TCAATCCGCCAGACACAGATATCCG), NL3 (forward: CCCAACGAAGATTGCCTCTAT, reverse: CGTCATTATCCGCTA AGTCCTC and probe TCCATCTTCCGTGGGCACATACAC),Cbln1 (forward: CTGCGTTCTGAGTCAAAGTTG, reverse: GAGCCGTCCGAGATGAGTA, and probe: CCCGATGTTCACTAGTACCTGGTCGA), Cbln2 (forward: ATTCCCTTTCTTGGTGCTACA, reverse: CGTACCATGACCATCTACTTCG, and probe AACCACTTTGACCTTGCCTCCAGT), Cbln4 (forward: GCCACAAAGACAGATTCCAATG, reverse: CAACCACGAGCCATCTGA, and probe AGCAACAAGACTCGCATCATTTACTTTGATC), GluRδ1 (mm.pt.58.32947175), GluRδ2 (mm.pt.58.12083939), and mouse actin (forward: ATGCCGGAGCCGTTGTC, reverse: CCGCCACCAGTTCGCCATG and probe GCGAGCACAGCTTCTTTG).

Electrophysiology Transverse (200μm) slices containing MNTB from P9 to P13 mice were made with a vibratome (LeicaVT1200S),similar as described previously7,8. Since different breeding background might affect synaptic properties, only littermates were used.The extracellular recording aCSF containing (in mM): 125 NaCl, 25 NaHCO3,2.5 KCl, 1.25 NaH2PO4, 25 glucose, 0.4 ascorbic acid, 3 myo-inositol, 2 Na-pyruvate, 2 CaCl2 and 1 MgCl2 (pH 7.4, when bubbled with 95% O2/5% CO2). For recordings of bipolar stimulation electrode (FHC) evoked EPSCs mediated by AMPA-type glutamate receptors (AMPARs), picrotoxin (50μM), strychnine (2μM), and APV (50 μM) were added to aCSF. For recordings of mEPSCs, additionaltetrodotoxin (TTX, 1μM) was added. Internal solutions in pipette including (in mM): 125 Cs-gluconate, 20KCL,10 Na2-phosphocreatine, 4 MgATP, 0.3 Na2GTP, 0.5 EGTA, 10 HEPES, 2 QX-314, pH 7.2. Cells were held at -60 mV in voltage-clamp with an Axon amplifier, under visualization of neurons with an upright microscope (BX51WI, Olympus, Tokyo, Japan) equipped with a 40× water immersion objective (Zeiss). Postsynaptic patch-pipettes had resistances of 2-3 MΩ, and series resistance (4-7 MΩ) was compensated between 75 and 85%. The residual Rs error in postsynaptic recordings were comparable in comparing genotypes (1±0.1 MΩ) and was not corrected off-line. EPSCs were evoked at interval of 15 s (an interval of 90 s for train stimulation) by extracellular stimulation with a bipolar tungsten electrode positioned halfway between the midline and the MNTB to ensure that the cells receive all-or-none calyceal inputs9.Previous report has shown that incubation with HA-Cbln1 at concentration of 30 ng/ml rescued the deficient phenotype of EPSC from parallel-fiber to Purkinje cell synapse in acute cerebellum slice of Cbln1-KO mice10. This incubation method was used to boost Cbln1 function at calyx of Held.For Cbln1 incubation experiments, after 1-hours recovery, brain slices were incubated with Cbln1 at concentration of 30 μg/ml for 3 hours, then fiber stimulation induced EPSCs at calyx of Held werecarried out in the presence of 30 μg/ml Cbln1. The electrophysiology recording was performed up to 2 hours after 3 hours incubation.

Cbln1 peptideSoluble recombinant HA-Cbln1-His was prepared as described previously11. Briefly, the cell medium was collected five days after the expression vector were transfected into the FreeStyle 293s (Invitrogen). Then the HA-Cbln1-His was purified by Talon mental affinity resin (Clontech) with manufacturer’s instructions and dialyzed against HBSS (Gibco). Protein concentration were quantified by SDS-PAGE and coomasssie staining together with BSA as the quantitative standard.

Immunoblotting Cerebellar extracts were run on sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and electrotransferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA). Membranes were probed with a rabbit polyclonal anti-Cbln1 E3 antiserum12. Bound antibody was detected by the ECL chemiluminescence system (Amersham, Piscataway, NJ).

Statistics Experiments were not randomized, but the experimenter was blinded to all conditions during data collection and processing. No data were excluded from the analyses. Data obtained were presented as mean ± s.e.m. Two-tailed unpaired Student'st-test and one-way ANOVA were used for statistical analysis of the differences among groups according to the number of samples. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar those generally employed in the field. Data distribution was assumed to be normal, but the distributionand variation of samples was not formally tested.p< 0.05 were considered significant.

REFERENCES:

1: Tabuchi K, Blundell J, Etherton MR, Hammer RE, Liu X, Powell CM, et al. A neuroligin-3 mutation implicated in autism increases inhibitory synaptic transmission in mice.Science2007, 318: 71-76.

2: Hippenmeyer S, Vrieseling E, Sigrist M, Portmann T, Laengle C, Ladle DR, et al. A developmental switch in the response of DRG neurons to ETS transcription factor signaling.PLoS Biol2005; 3:e159.

3: Han Y, Kaeser PS, Südhof TC, Schneggenburger R. 2011. RIM determines Ca 2+ channel density and vesicle docking at the presynaptic active zone.Neuron,69:304-316.

4: Zhang B, Chen LY, Liu X, Maxeiner S, Lee SJ, Gokce O, et al. Neuroligins Sculpt Cerebellar Purkinje-Cell Circuits by Differential Control of Distinct Classes of Synapses. Neuron 2015; 87:781-796.

5: Liu P., Jenkins N A, Copeland NG. A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res. 2003;13:476–484.

6: Aoto J, Martinelli DC, Malenka RC, Tabuchi K, Südhof TC. Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.Cell 2013;154:75-88.

7: Zhang B, Sun L, Yang Y-M, Huang H-P, Zhu F-P, Wang L et al. Action potential bursts enhance transmitter release at a giant central synapse. J Physiol 2011; 589: 2213–27.

8: Acuna C, Liu X, Gonzalez A, Südhof TC. RIM-BPs Mediate Tight Coupling of Action Potentials to Ca2+-Triggered Neurotransmitter Release. Neuron 2015; 87: 1234–1247.

9: Forsythe ID, Barnes-Davies M. The binaural auditory pathway: membrane currents limiting multiple action potential generation in the rat medial nucleus of the trapezoid body. Proc Biol Sci 1993; 251: 143–50.

10: Ito-Ishida, Aya, et al. "Cbln1 regulates rapid formation and maintenance of excitatory synapses in mature cerebellar Purkinje cells in vitro and in vivo.The Journal of Neuroscience2008; 28: 5920-5930.

11: Uemura, T., & Mishina, M. The amino-terminal domain of glutamate receptor δ2 triggers presynaptic differentiation.Biochemical and biophysical research communications,2008; 377, 1315-1319.

12: Bao D, Pang Z, Morgan MA, Parris J, Rong Y, Li L, Morgan JI. Cbln1 is essential for interaction-dependent secretion of Cbln3. Mol. Cell. Biol. 2006;26:9327–9337.

B. SUPPLEMENTAL FIGURES and FIGURE LEGENDS

Figure S1:Generation of Cbln1fl/fl and Cbln1-/- mice

(A) Gene targeting strategy. Exon 3 of the Cbln1 gene was flanked by a loxP site using homologous recombination in ES cells, and a neomycin resistance cassette was inserted for selection. The elimination of the loxP-flanked region by Cre-recombinase generates Cbln1-null allele.

(B) Confirmation of Cbln1 KO by Southern blotting. BglII-digested genomic DNA from ES cells (left panel) and mouse tissue (right panel) is subjected to Southern blotting hybridization using a digoxigenin (DIG)-labeled 5’ and 3’external probes. Bands with the indicated sizes denote correct targeting in both ES cells and tail tissues.

(C) Immunoblotting of cerebellar lysates from Cbln1fl/fl and Cbln1-/- mice using an anti-Cbln1 E3 antiserum. The arrow shows the location of full length Cbln1 and the arrow heads show the location of sub-monomeric fragments of Cbln1.

Figure S2:Measurements of mRNA levels of neuroligins, cerebellins, and GluRδ1 and GluRδ2 in the MNTB during development

(A) Illustration of brainstem auditory system. Neurons in the VCN generate Calyx of Held in the contralateral MNTB. MNTB, medial nucleus of the trapezoid body; VCN, ventral cochlear nucleus; Dashed lines show cuts made to extract MNTB tissue for RNA collection.

(B-D), Plots of NLs, Cbln1, and GluRδ mRNA measurements in MNTB during development. WT mice brains were quickly dissected and coronal sliced at a thickness of 200 µm in ice-cold, low Ca2+ aCSF at postnatal day 1 (P1), P3, P4,P7, P11, and P18. P1 was defined as being 24-48 hours after birth. Slices from littermate were started on P1 and then collected on subsequent days. Slices with discernible MNTB regions on both sides of the tissue were collected for the experiments. An enriched population of MNTB cells were carefully dissected out using a 26-gauge needle under a dissecting scope. The dissected tissue was transferred directly into TRIzol reagent (qPCR; Invitrogen, Carlsbad, CA) and frozen at -80°C. RNA extraction was carried out using TRIzol reagent and quantified using a ND-1000 spectrophotometer. The amounts of mRNA were normalized to actin. Each development time point was averaged from 3-4 separated repeats, with each repeat containing tissues containing MNTB from 3-4 mice.

(E-F), Plots of NL3 and Cbln1 mRNA measurements in MNTB during development with PV-NL3 mice and Krox-NL3 mice. The data show that in Krox-Cre-NL3 mice, mRNA levels of NL3 became nearly undetectable at P1, and were undetectable afterwards, whereas Cbln1 mRNA levels were largely unchanged compared to those in MNTBs from WT pups in Fig. S2C. The data also show that in PV-Cre-NL3 mice, mRNA levels of NL3 started to decrease only after P7 (compared to an increase of NL3 mRNA levels after P7 in WT mice as shown in Fig. S2B), whereas Cbln1 mRNA levels were again unchanged compared to those in MNTBs from WT mice.

1

Figure S3:Measurements of mEPSCs in the calyx synapse of NL3 KO (A), R451C-knock-in (B), and R704C-knock-in mice (C)

(A), Samples and summary data of mEPSC recorded from P9-11 MNTB neurons from control (black traces) and NL3 constitutive KO (NL3-KO, red traces) littermate.

(B), Samples and summary data of mEPSC recorded from P9-11 MNTB neurons from control (black traces) and NL3 R451C knock-in mice (R451C, red traces) littermate.

(C), Samples and summary data of mEPSC recorded from P9-11 MNTB neurons from control (black traces) and NL3 R704C knock-in mice (R704C, red traces) littermate.

Data are presented as means ± SEM. The numbers in bars represent the number of cells/the number of mice used. Statistical significance was determined by Two-tailed Student’s t-test.

Figure S4:Measurement of mEPSC from PV-NL3 and Krox-NL3 (A-B),EPSCs recorded from Krox-NL1/3 mice and their littermate control (C) and Krox-NL3 mice or control mice in the presence of Cbln1 (D).

(A), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and PV-NL3 mutant mice (PV-NL3, red traces) littermate.

(B), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and Krox-NL3 mutant mice (Krox-NL3, red traces) littermate.

(C), Samples and summary data of EPSC recorded from P11-13 MNTB neurons from control (black traces) and Krox-NL1/3 double mutant mice (Krox-NL1/3, red traces) littermate.

(D), Samples and summary data of EPSC recorded from P11-13 MNTB neurons from control (black traces) and Krox-NL3 mutant mice (Krox-NL3, red traces) littermate after 3 hours incubation of 30 µg/ml HA-Cbln1 peptide.

Data are presented as mean ± SEM. The numbers in bars represent the number of cells/the number of mice used. Statistical significance was determined by two-tailed Student’s t-test.

Figure S5:Breeding scheme for the generation of tissue specific conditional KO mice for NL3 and Cbln1

We crossed male heterozygous Krox20+/Cre mice with female NL3 floxed mouse line (A), and with female Cbln1 floxed mouse line (B). The resulting male offspring (F1 generation) were further crossed against the NL3 female floxed mice, by taking advantage of X-chromosome localization of NL3. When mice carry a Cre knock-in allele in the Krox20 locus, the floxed NL3 alleles is expected to be removed in Cre-expressing cells from ~ E9 onwards due to germline recombination. Therefore, synapses recorded from these male mice were called "Krox-NL3" synapses (for prenatal conditional NL3 KO). Cre- negative male littermate NL3fl/Y mice were used for control measurements. To generate Krox-Cbln1-NL3 double conditional KO mice, same strategy was used (C). Similar breeding strategies was used as in A-Cto generate PV/Cre mediated NL3 and Cbln1 single and double conditional knockout mice. Note that no germline recombination was observed with PV/Cre mouse line.

Figure S6:Measurements of mEPSCs from PV-Cbln1 and Krox-Cbln1 mutant calyx synapses

(A), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and PV-Cbln1 mutant mice (PV-Cbln1, red traces) littermate.

(B), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and Krox-Cbln1 mutant mice (Krox-Cbln1, red traces) littermate.

Data are presented as mean ± SEM. The numbers in bars represent the number of cells/the number of mice used. Statistical significance was determined by two-tailed Student’s t-test.

Figure S7:Measurements of mEPSCs from Krox-Cbln1-NL3 and PV-Cbln1-NL3 double conditional KO calyces

(A), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and PV-Cbln1-NL3 mutant mice (PV-Cbln1-NL3, red traces) littermate.

(B), Samples and summary data of mEPSC recorded from P11-13 MNTB neurons from control (black traces) and Krox-Cbln1-NL3 mutant mice (Krox-Cbln1-NL3, red traces) littermate.

Data are presented as mean ± SEM. The numbers in bars represent the number of cells/the number of mice used. Statistical significance was determined by two-tailed Student’s t-test.

1