Tetrahymena Thermophilia Cyclin Gene, TTHERM 00780580, Expression During Conjugation

Tricia Windgassen

12/8/09

BIO464 Lab 2009 Bradley University

Tetrahymena thermophilia cyclin gene, TTHERM_00780580, expression during conjugation

Abstract:

Many different cyclins respond to and control the movement of the cell through the different phases of the cell cycle. This study looked at the expression of the Tetrahymena thermophilia cyclin gene, TTHERM_00780580, during conjugation, the ciliate sexual cycle, to determine if this cyclin, and cyclins in general, are involved in the regulation of conjugation steps. This study named this cyclin gene CYC16. Observing when this cyclin is expressed may lead to hypotheses about what specific event this cyclin regulates. Reverse Transcription PCR (RT PCR) was run on mRNA extracted from Tetrahymena thermophilia cells that were in each hour of the 18 hour conjugation. An expression profile of the cyclin gene during conjugation was constructed using the RT PCR gel electrophoresis results. Expression increased and decreased many times during conjugation but the largest peak was at conjugation hour 5, suggesting that this cyclin may be involved in selecting the 1 haploid nucleus (of 4 pronuclei from meiosis) that is exchanged with another cell before fertilization. This study’s conjugation cyclin gene expression profile did not closely agree with the Tetrahymena Gene Expression Database’s (TGED) expression profile for this cyclin, which peaked significantly at conjugation hour 0.

Introduction:

Cyclins are proteins that regulate the activity of cyclin-dependent kinases (CDKs), which control theevents of cell cycle phases andmovement into the next phases. Cyclins bind to the free, inactive CDKs, activating the CDKs (Zhanget al. 1999). These active CDKscan then phosphorylate proteins that control events of the cell cycle such as DNA replication, chromosome condensation, spindle formation, and cytokinesis. For each part of the cell cycle, specific cyclins promote the events of that phase of the cell cycle and keep the cell in that phase. A cyclin builds up in the cell, pushing the cell into that cyclin’s phase of the cell cycle by activating CDKs that promote the events of that phase. When that phase is complete, the cyclin disappears and the next cyclin is expressed, moving the cell into the next stage of the cell cycle. A search on the Tetrahymena Gene Expression Database (TGED) found the Tetrahymena thermophiliagene, CYC16 (TTHERM_00780580), to be a cyclin. As a cyclin, this gene is likely involved in a part of the cell cycle.

Tetrahymena thermophiliaare free-living freshwater ciliate protozoans that have two nuclei, the macronucleus and the micronucleus. The micronucleus is diploid, divides mitotically, and is transcriptionally silent. The macronucleus is polyploidy and its genome is expressed during vegetative growth, determining the cell’s phenotype. The macronucleus divides amitotically by randomly separating the chromosomes into the daughter nuclei (Miao et al. 2009). TwoTetrahymena thermophiliacell types of the seven mating types will undergo conjugation if they are mixed together after being stressed, such as being starved. Conjugation in Tetrahymena involves a series of meiotic and mitotic nuclear divisions, exchange of haploid nuclei between two cells, nuclear fusions, DNA elimination, DNA amplification, nuclear destructions, and nuclear development. Miao et al. showed the steps of conjugation in their paper (figure 1).

Figure 1. Conjugation steps in Tetrahymena (Miao et al. 2009).

As a cyclin, the Tetrahymena thermophiliagene, TTHERM_00780580, should be involved in the cell cycle. The expression profile for this gene at TGED showed that this gene was expressed during vegetative growth, starvation, and conjugation in Tetrahymena( This study observed when TTHERM_00780580 was expressed during conjugation in Tetrahymena thermophilia to determine possible events this cyclin controls.

Methods:

The cyclin gene was identified at the Tetrahymena Genome Database ( by searching for proteins with the keyword “cyclin”. A BLAST search with a cyclin protein sequence ensured that all cyclin genes were identified using this method. Microarray data during conjugation (Miaoet al.2009) were collected for the gene from the Tetrahymena Gene Expression Database (TGED; PCR primers were generated for the gene using Primer3 (Steve Rozen and Helen J. Skaletsky 2000) and ordered from Integrated DNA Technology (Coralville, IA). Oligo-dT-primed M-MLV reverse transcription (RT; Ambion) was performed on RNA collected from control cells and from cells at various stages of conjugation using the Trizol reagent (Invitrogen) according to the manufacturer’s protocol. 1 mL of cells (2.1 x 103 cells/mL) was collected at each time point, pelleted at 6k rpm, supernatant discarded, and cells resuspended in 1 mL of Trizol. 180 ng of template RNA was used per reverse transcription reaction. cDNA was diluted 1:5 and used as a template for PCR. PCR was performed in 25 uL reactions using GOTaq (Fisher, Hampton, NH) with 1 uL of each primer (10 uM). 15 uL of completed PCR reaction products were separated on a 2% agarose gel. DNA bands were visualized using ethidium bromide and photographed with a Kodak EDAS290 imaging system. Band intensities were determined using ImageJ (Abramoffet al. 2004).

Results:

The Tetrahymena Genome Database provided the TTHERM_00780580 genetic sequence in Figure 2. Because this gene does not contain introns, the sequence in figure 2 is the genetic sequence and the coding sequence. This sequence was used to make the primers (in yellow) for reverse transcription PCR (RTPCR).

>TTHERM_00780580(gene)

ATGCAAAAAGCTCCATAATAGCAAAAGTTTAGTACTTCAAATACTTTGTTTATCCGTCATACGATTTCATCTCCAAATGTGAAATCTATTATTTAGGCAGTAGCTACTATTCTTCACTCTTAAATGCACGAAGATTTCTAATCAGGAAAAGAAGTTCCTAAAGGTTCTGACCTTCATTTCTTCTCTGAAGAAAAATATATTGAAGAAAAACCAGAAGAGTTCGATGAAGCTCGTCGTGCCTTGCTTCGTGAAACTCCATCTGTAGATAACATTTATGAATTTATGAAAGCTCTTTATGAATGTGCCAAATTCTCTCCTGAATGCTGCATTATCTGTTTAGTTTACATTAATAGATTGATTGCATTCACAGGTTTGCCTCTTTATCCAACAAACTGGCGTCCTCTTATCCTTTGCTCTTTATTAGTAGCACAAAAAGTATGGGATGACAAGTACTTATCAAATGCTGACTTTGCTTTCATCTATCCTTTCTTCGTTACTGAAGAAATCAATGCTTTAGAACAAAAGTTCCTTGAATTACTCTAATACAATGTCACTGTAAAAAGTGCTCTTTATGCTAAATACTACTTTGAATTAAGAGCCCTCTTTAAAAACGAATCTGAATTCCCCTTAACCCCTCTTGATGTTGATCAAGAAAAGGAACTCGAATCAAGATCTTAATAAATGTAAAACAAAGAAAAAGAAAAAGCATAAAAGAATTCTCTCACTTATAACGAGAAGCAAACCAAAAGACCTAATGCCTCTCTTAATGTATGA

Figure 2. TTHERM_00780580 genomic DNA sequence from Tetrahymena Genome Database, with primer regions highlighted in yellow. This gene has no introns. (

The Tetrahymena Gene Expression Database’s (TGED) expression profile for TTHERM_00780580 (figure 3) showed expression during vegetative growth, starvation, and conjugation. Expression of this cyclin peaked at its highest point at conjugation hour 0 (C0) and immediately decreased until C3. From C3 to C18 expression increased with slight humps at C6 and C10.

Figure 3. Microarray expression profile for TTHERM_00780580from TGED, where L= vegetative log phase growth. S= hours under starved conditions. C= conjugation hours after mixing equal volumes of B2086 and CU428 cells (

Gel Electrophoresis of the RTPCR products (figure 4), showed expression of TTHERM_00780580 increased and decreased many times over the 18 hours of conjugation. This gene was expressed at all the time points except for conjugation hour 4 (C4), due to experimental error. The brightest band during conjugation is at C5, with increases in decreased in brightness throughout the conjugation hours.

Fig. 4. RTPCR gel electrophoresis of TTHERM_00780580. Well 1: Fisher Full Scale 1kb DNA ladder. Well 2: RTPCR product of CU428 genomic DNA template containing introns. Well 3,4: RTPCR product from CU427 and CU428 in vegetative growth hours. Well 5,6: RTPCR product from CU427 and CU428 starved hours. Well 7-14: RTPCR product from Tetrahymena in conjugation hours 0-7. Well 15: Fisher Full Scale 1kb DNA ladder. Well 16-26: RTPCR product from Tetrahymena in conjugation hours 8-18.

The expression profile for TTHERM_00780580 (figure 5), constructed from the intensities of the bands in the RTPCR electrophoresis gel, showed many increases and decreases in expression. After a small peak at C0, expression increased sharply from C1 to the highest point at C5 and decreased sharply from C5 to C8 with a hump at C7. Expression increased at C9-C11 and C15.

fig. 5. Expression profile for TTHERM_00780580. Intensities of the bands in the gel

electrophoresis for the two vegatative growth hours (V), two starvation hours (S), and conjugation hours (C0-C18, excluding C4).

Discussion:

Reverse Transcriptase PCR from RNA extracted from Tetrahymena thermophila cells over 18 hours of conjugation showed that expression of CYC16 (TTHERM_00780580) increased and decreased multiple times but the greatest amount of expression occurs at C5. Expression of the cyclin increases from C1 up to its highest peak at C5 and decreases after from C5 to C8. At C5 in Tetrahymena conjugation, 1 of the 4 meiotic products is selected to later undergo haploid mitosis and exchange nuclei with another cell. This cyclin may activate cyclin-dependent kinases that activate the association of microtubules with 1 pronucleus and the movement of the pronuclei, allowing for the selection of this fourth pronucleus from the other 3 nuclei. The fourth nucleus is position selected for from the other nuclei by association through microtubules with the conjugal transfer junction (Gaertig and Fleury 1992Gaertig, J. and A. Fleury. 1992. Spatiotemporal reorganization of intracytoplasmic microtubules is associated with nuclear selection and differentiation during developmental process in the ciliate Tetrahymena thermophila. Protoplasma 167:74–87. See All References). This network of microtubules at the transfer junction later enables the exchange of pronuclei between mating cells at conjugation hour 5.75, when this cyclin is still highly expressed. This cyclin may be involved in activating the binding of kinesin and dynein (motor protein that move along microtubules) to the pronucleus and signaling these motor proteins to transport the pronucleus to the conjugal transfer junction. If Cyc16p (the TTHERM_00780580 protein) is involved in signaling microtubular motor protein binding and movement or microtubular polymerization, then this may explain the continued expression of this cyclin during vegetative growth, starved, and conjugational conditions. This would explain this continued expression because microtubular polymerization and motor protein movement occur often in the cell and in many phases of the cell cycle. The 3 haploid nuclei that are not selected for exchange are degraded around C5 also. Santos et al. (2000)found that the 3 haploid nucleimay be degraded by a mechanism similar to the one that degrades the macronucleus. Thus, TTHERM_00780580 cyclin may not be involved in the programmed degradation of the 3 haploid nuclei since there is not a peak in expression later, during degradation of the macronucleus, similar to the peak at C5. The decrease in the cyclin after C5 may allow the selected nuclei to proceed into haploid mitosis.

This study’s conjugation cyclin gene expression profile did not agree with the Tetrahymena Gene Expression Database’s (TGED) expression profile for TTHERM_00780580. TGED’s expression profile for this cyclin showed the largest peak at C0, sharp decrease to the lowest points from C2 to C4, and a slow increase in expression until C18 with increased expression bumps at C6 and C10 ( Expression at C0 may be due to the cyclin helping prepare the cell for mating and cell pairing. Decreasing expression after C0 would allow the cell to proceed through meiosis. The small increase at C6 may correspond to this study’s peak at C5, since expression profiles for other cyclins, acquired by the same method as this study, appeared to be an hour off from TGED’s expression profiles for those cyclins. In this study, a small increase in expression occurred at C0 but the largest amount of expression was not at C0, as it was in the TGED microarray profile.

By determining when cyclins are expressed, we get closer tocomprehending what cyclins control. This helps us better understand how the cell cycle is controlled and this may lead to ways we could control the cell cycle. Research on cyclins may lead to possible treatments for cancer cells (cells that progress through the cell cycle unregulated). Overexpression of Cyclin D was found in a type of breast cancer, Ductal carcinoma in situ, leading to research on decreasing cyclin expression in order to help prevent proliferation of tumor cells (Steeg and Zhou 1998).

References:

Abramoff, M.D., Magelhaes, P.J., Ram, S.J. (2004). Image Processing with ImageJ.

Biophotonics International. 11 (7): 36-42.

Gaertig, J. and A. Fleury. (1992). Spatiotemporal reorganization of intracytoplasmic

microtubules is associated with nuclear selection and differentiation during

developmental process in the ciliate Tetrahymena thermophila.Protoplasma. 167:74–87.

Miao, W., Xiong, J., Bowen, J, Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman, R.E., Orias, E., Gorovsky, M.A. (2009). Microarray Analyses of Gene Expression during the Tetrahymena thermophila Life Cycle. PLoS ONE. 4(2)

Santos, M.L., Lu, E., Wolfe, J. (2000). Nuclear Death in living Tetrahymena: The case of the haploid nuclei. The Journal of Eukaryotic Microbiology. 47 (5): 493-498.

Steeg, P.S. and Zhou, Q. (1998). Cyclins and Breast Cancer. Breast Cancer Research and Treatment. 52: 17-28.

Tetrahymena Gene Expression Database (TGED). < (Accessed 11/20/09).

Tetrahymena Genome Database. < (Accessed 11/20/09).

Zhang, H., Adl, S.M., Berger, J.D. (1999). Two Distinct Classes of Mitotic Cyclin Homologues, Cyc1 and Cyc2, Are Involved in Cell Cycle Regulation in the Ciliate Paramecium tetraurelia. Journal Eukaryote Microbiology. 46 (6): 585-596.