ELECTRONIC SUPPLEMENTARY MATERIAL

ESM 1-Assessment of BRCA1 promoter methylation status

Supplemental Fig. esm1 illustrates the strategy for the assessment of BRCA1 promoter methylation using next-generation sequencing.

Bisulfite sequencing was performed to determine the methylation levels of 19 CpG sites in the promoter region of the BRCA1 gene. A total of 500 ng of tumor genomic DNA was used for bisulfite conversion using the EZ DNA Methylation-Gold (Zymo Research, USA) kit, according to the manufacturer’s protocol. Bisulfite-treated DNA was eluted in 20 uL after 1 min centrifugation, instead of 10 uL and 30 s centrifugation as in the protocol, and stored at -20°C until later use.

The target region was amplified in a 45-cycle PCR, with 1.25 units Platinum Taq DNA Polymerase High-Fidelity (Invitrogen, Carlsbad, USA), 0.2 mM dNTPs, 2 mM MgCl2, and 0.2 mM each of forward (5’ GAGGGTGAAGGTTTTTTG 3’) and reverse (5’ CAACAATTACTATAATACAATAAACC 3’) primers. PCR products were verified in 1% SYBR-Safe-agarose gels, purified using 1.8X Agencourt AMPure XP (Beckman Coulter, USA), and quantified using Qubit (Quant-iT™ dsDNA HS) (Thermo Fisher, USA).

For allowing adapter ligation, at least 20 ng (300 ng max) of purified PCR products were submitted to end repair and A-tailing with 2.5 units of DNA polymerase 1, Large (Klenow) Fragment (New England Biolabs), 10 units of T4 polynucleotide kinase (Invitrogen, Carlsbad, USA) and 0.5 mM dATP at 37°C for 30 min, followed by purification with 1.8X Agencourt AMPure XP. Prior to ligation, DNA adapters were assembled. The Y-shaped barcoded adapters were formed by two oligos: i) oligo 454A, which presents a T-overhang after assembly; and ii) oligo 454Brc, phosphorylated with 10 units of T4 polynucleotide. Assembly was performed in a thermal cycler at 1°C/ramp at 95°C for 2 min, 65°C for 10 min, 37°C for 10 min and 20°C for 20 min. Next, assembled Y-shaped barcoded DNA adapters were added to DNA fragments with 4 units of T4 DNA ligase at 16°C overnight. Next, purified (1.8X Agencourt AMPure XP) ligated fragments were amplified in a 12-cycle PCR, with 1.25 units Platinum Taq DNA Polymerase High-Fidelity (Invitrogen, Carlsbad, USA), 0.2 mM dNTPs, 2 mM MgCl2, and 0.2 mM each of forward (5’ CGTATCGCCTCCCTCGCGCCATCAG 3’) and reverse (5’ CTATGCGCCTTGCCAGCCCGCTCAG 3’) primers for final library generation. Library products were purified with 1.8X Agencourt AMPure XP, quantified by Qubit (Quant-iT™ dsDNA HS) and analyzed with an Agilent High Sensitivity DNA Kit in a Bioanalyzer 2100 equipment to check the ligation and to determine the molarity. Equivalent masses of each sample were pooled and submitted to emulsion PCR (emPCR) according to the GS Junior Titanium emPCR Amplification Method Manual, Lib-A (March 2012) and sequenced as instructed by the GS Junior Titanium Sequencing Method Manual (January 2013).

The BRCA1 read files in the sff format were split according to their barcodes using the program sfffile from the SFFtools package. Next, these files were converted to Fastq format using the program sff2fastq ( and mapped to the reference human genome (Hg19) using BWA-SW[1]. The alignment in sam format was converted to bam using samtools. The package GenomicAlignments[3] from R-Bioconductor was used inside a R function to calculate the frequency of “C” or “T” nucleotides at the CpG sites described above and at control sites, defined as “C” sites not followed by “G” sites in the reference sequence. Such control sites should not be methylated; hence, the frequency of “T” in these sites was considered the conversion rate, and the frequency of “C” at CpG sites was considered the methylation level.

For the categorization of samples as hypermethylated and non-hypermethylated, we used a maximally selected rank statistics analysis[4]. This approach considered the outcome of patients from the whole cohort to estimate a methylation value that better segregated the two groups. For this analysis, a methylation measurement of 0.03 (3%) was treated as sequencing noise and was considered zero. The results indicated 16.1% methylation as the threshold for classifying a sample as hypermethylated.

1. Li H, Durbin R (2010) Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26:589–595. doi: 10.1093/bioinformatics/btp698

2. Li H, Handsaker B, Wysoker A, et al (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078–2079. doi: 10.1093/bioinformatics/btp352

3. Lawrence M, Huber W, Pagès H, et al (2013) Software for Computing and Annotating Genomic Ranges. PLoS Comput Biol 9:e1003118. doi: 10.1371/journal.pcbi.1003118

4. Lausen B, Schumacher M (1992) Maximally Selected Rank Statistics. Biometrics 48:73–85.

Supplemental Fig. esm1: a) A segment of 390 bp encompassing 19 CpG sites from the BRCA1 promoter region (-191 to +199) was PCR amplified. PCR products were purified, blunt ended and A-tailed for allowing b) ligation with a customized Y-shaped barcoded adaptor. c) Low-cycle PCR was performed to generate a linear barcoded DNA library ready for massive parallel sequencing in the 454 GS Junior platform.

Supplemental Fig. esm2: a) Overall survival curves for patients diagnosed with BRCA1-mutated (red line), BRCA1-hypermethylated (green line) or BRCA-proficient (blue line) triple-negative breast cancer (log-rank test, p=0.1375). b) Overall survival for patients diagnosed with BRCA1-impaired (orange line) or BRCA-proficient (blue line) triple-negative breast cancer (log-rank test, p=0.0807). c) Disease-free survival for patients diagnosed with BRCA1-mutated (red line), BRCA1-hypermethylated (green line) or BRCA-proficient (blue line) triple-negative breast cancer (log-rank test, p=0.1037). d) Disease-free survival for BRCA-impaired (orange line) or BRCA-proficient (blue line) triple-negative breast cancer (log-rank test, p=0.0744). e) Overall survival for patients diagnosed with BRCA-impaired (orange line) or BRCA-proficient (blue line) triple-negative breast cancer submitted to post-operative (adjuvant) chemotherapy (log-rank test, p=0.1028). f) Disease-free survival for BRCA-impaired (orange line) or BRCA-proficient (blue line) triple-negative breast cancer submitted to post-operative (adjuvant) chemotherapy (log-rank test, p=0.0746).

Supplemental Fig. esm3: a) Overall survival curves for patients diagnosed with positive family history of breast/ovarian cancer (pink line) or negative family history of breast/ovarian cancer (green line) triple-negative breast cancer (log-rank test, p=0.3383). b) Overall survival curves for patients diagnosed up to 40 yo with positive family history of breast/ovarian cancer (pink line) or negative family history of breast/ovarian cancer (green line) triple-negative breast cancer (log-rank test, p=0.4799). c) Disease-free survival for patients diagnosed with positive family history of breast/ovarian cancer (pink line) or negative family history of breast/ovarian cancer (green line) triple-negative breast cancer (log-rank test, p=0.7149). d) Disease-free survival for patients diagnosed up to 40 yo with positive family history of breast/ovarian cancer (pink line) or negative family history of breast/ovarian cancer (green line) triple-negative breast cancer (log-rank test, p=0.5755.

Supplemental Fig. esm4: Family history of Breast/Ovarian cancer according to age group of triple-negative breast cancer diagnosis (X² test, p=0.6433)

Table esm1: BRCA1 promotor methylation results from bisulfite next generation sequencing

Sample ID / Mean Methylation / Mean Conversion / Mean Coverage / BRCA1 promoter status
4956 / 48.98% / 99.47% / 469 / Hypermethylated
5528 / 0.92% / 99.66% / 3624 / non-hypermethylated
17755 / 66.65% / 99.54% / 1309 / Hypermethylated
17791 / 0.50% / 99.22% / 1864 / non-hypermethylated
18030 / 0.46% / 99.47% / 1268 / non-hypermethylated
19064 / 0.37% / 99.61% / 3898 / non-hypermethylated
19088 / 18.48% / 98.94% / 1348 / Hypermethylated
M7 / 15.85% / 99.25% / 2503 / non-hypermethylated
M15 / 44.11% / 99.54% / 1839 / Hypermethylated
M255 / 0.62% / 99.45% / 2584 / non-hypermethylated
M256 / 1.52% / 99.29% / 719 / non-hypermethylated
M257 / 2.09% / 99.45% / 3305 / non-hypermethylated
M259 / 8.07% / 99.53% / 190 / non-hypermethylated
M260 / 0.64% / 99.47% / 2101 / non-hypermethylated
M261 / 0.57% / 99.52% / 2825 / non-hypermethylated
M262 / 0.41% / 99.57% / 2562 / non-hypermethylated
M264 / 0.97% / 99.28% / 2015 / non-hypermethylated
M265 / 0.60% / 99.43% / 1910 / non-hypermethylated
M266 / 0.82% / 99.55% / 1509 / non-hypermethylated
M267 / 0.98% / 99.44% / 2534 / non-hypermethylated
M268 / 1.50% / 99.43% / 2566 / non-hypermethylated
M269 / 2.12% / 99.21% / 125 / non-hypermethylated
M274 / 60.02% / 99.57% / 3754 / Hypermethylated
M275 / 13.13% / 99.50% / 3341 / non-hypermethylated
M276 / 1.34% / 99.42% / 412 / non-hypermethylated
M277 / 0.80% / 99.40% / 4033 / non-hypermethylated
M278 / 7.96% / 99.64% / 3714 / non-hypermethylated
M280 / 0.61% / 99.23% / 2237 / non-hypermethylated
M281 / 0.55% / 99.51% / 2831 / non-hypermethylated
M282 / 1.12% / 99.48% / 632 / non-hypermethylated
M283 / 0.57% / 99.54% / 1561 / non-hypermethylated
M284 / 3.89% / 98.96% / 1588 / non-hypermethylated
M285 / 0.78% / 99.30% / 2275 / non-hypermethylated
M286 / 6.76% / 99.39% / 7546 / non-hypermethylated
M287 / 0.42% / 99.55% / 1636 / non-hypermethylated
M288 / 0.51% / 99.69% / 3690 / non-hypermethylated
M290 / 0.85% / 99.53% / 4027 / non-hypermethylated
M291 / 0.70% / 99.56% / 3919 / non-hypermethylated
M292 / 0.62% / 99.41% / 4207 / non-hypermethylated
M293 / 16.09% / 99.42% / 1426 / non-hypermethylated
M298 / 0.89% / 99.23% / 251 / non-hypermethylated
M299 / 33.62% / 99.39% / 13580 / Hypermethylated
M300 / 1.10% / 99.24% / 17507 / non-hypermethylated
M302 / 0.28% / 99.21% / 381 / non-hypermethylated
M303 / 2.13% / 99.29% / 7961 / non-hypermethylated
M304 / 54.64% / 99.42% / 899 / Hypermethylated
M305 / 0.87% / 99.14% / 431 / non-hypermethylated
M308 / 1.64% / 99.25% / 361 / non-hypermethylated
M309 / 1.57% / 99.21% / 1653 / non-hypermethylated
M310 / 7.06% / 99.47% / 4056 / non-hypermethylated
M311 / 0.79% / 99.49% / 2630 / non-hypermethylated
M312 / 10.09% / 99.39% / 362 / non-hypermethylated
M313 / 31.18% / 99.37% / 3835 / Hypermethylated
M314 / 0.58% / 99.31% / 1962 / non-hypermethylated
M315 / 1.09% / 98.97% / 1117 / non-hypermethylated
M319 / 0.56% / 99.55% / 2212 / non-hypermethylated
M320 / 0.49% / 98.71% / 237 / non-hypermethylated
M321 / 0.26% / 98.38% / 349 / non-hypermethylated
M322 / 1.32% / 99.62% / 846 / non-hypermethylated
M323 / 0.43% / 99.06% / 86 / non-hypermethylated
M324 / 0.67% / 99.62% / 1786 / non-hypermethylated
M325 / 27.28% / 99.02% / 3043 / Hypermethylated
M326 / 53.11% / 99.62% / 1425 / Hypermethylated
M340 / 1.93% / 99.00% / 315 / non-hypermethylated
M341 / 0.80% / 99.14% / 1615 / non-hypermethylated
M344 / 67.02% / 99.32% / 1676 / Hypermethylated
M345 / 0.55% / 99.25% / 2244 / non-hypermethylated
M346 / 2.01% / 99.40% / 1064 / non-hypermethylated
M347 / 34.68% / 98.32% / 195 / Hypermethylated
M348 / 2.44% / 99.67% / 272 / non-hypermethylated
M350 / 0.24% / 99.03% / 352 / non-hypermethylated
M351 / 0.69% / 99.16% / 1949 / non-hypermethylated
M352 / 1.67% / 98.77% / 2341 / non-hypermethylated
M355 / 0.34% / 99.58% / 404 / non-hypermethylated
M357 / 23.35% / 97.85% / 14768 / Hypermethylated
M358 / 2.09% / 97.63% / 1046 / non-hypermethylated
M360 / 22.79% / 99.33% / 1898 / Hypermethylated
M361 / 2.72% / 99.21% / 1957 / non-hypermethylated
M362 / 0.92% / 99.33% / 1579 / non-hypermethylated
M363 / 36.56% / 98.20% / 173 / Hypermethylated
M364 / 0.80% / 99.60% / 3341 / non-hypermethylated
M365 / 40.37% / 99.27% / 2352 / Hypermethylated
M366 / 38.62% / 99.44% / 14226 / Hypermethylated
M367 / 1.85% / 98.93% / 366 / non-hypermethylated
M368 / 0.38% / 99.40% / 1917 / non-hypermethylated
M369 / 0.38% / 99.25% / 1315 / non-hypermethylated
M370 / 0.39% / 99.43% / 19885 / non-hypermethylated
M371 / 0.45% / 99.59% / 1733 / non-hypermethylated
M372 / 0.42% / 99.51% / 9057 / non-hypermethylated
M373 / 0.42% / 98.73% / 179 / non-hypermethylated
M374 / 1.33% / 98.12% / 249 / non-hypermethylated
M377 / 42.01% / 99.34% / 3030 / Hypermethylated
M378 / 0.43% / 99.18% / 28587 / non-hypermethylated
M379 / 45.53% / 99.38% / 2738 / Hypermethylated
M380 / 0.65% / 99.31% / 1634 / non-hypermethylated
M381 / 0.55% / 99.54% / 3270 / non-hypermethylated
M384 / 0.35% / 99.56% / 1895 / non-hypermethylated
M385 / 38.02% / 99.50% / 2010 / Hypermethylated
M386 / 0.36% / 99.34% / 2082 / non-hypermethylated
MIC20 / 0.41% / 99.19% / 1366 / non-hypermethylated
MIC21 / 1.50% / 98.94% / 3121 / non-hypermethylated
MIC25 / 0.84% / 99.62% / 1989 / non-hypermethylated
MIC68 / 19.63% / 99.26% / 1917 / Hypermethylated
MIC82 / 30.55% / 98.77% / 3627 / Hypermethylated
MIC134 / 1.61% / 98.58% / 337 / non-hypermethylated
MIC137 / 32.17% / 98.74% / 497 / Hypermethylated
MIC141 / 2.79% / 97.88% / 282 / non-hypermethylated
MIC142 / 1.47% / 98.18% / 348 / non-hypermethylated
MIC144 / 25.22% / 99.34% / 438 / Hypermethylated
MIC146 / 0.93% / 99.64% / 2354 / non-hypermethylated
MIC175 / 2.21% / 99.62% / 1235 / non-hypermethylated
MIC177 / 0.64% / 98.98% / 1566 / non-hypermethylated
MIC180 / 67.76% / 99.12% / 705 / Hypermethylated
MIC183 / 5.08% / 96.53% / 53 / non-hypermethylated
MIC185 / 0.53% / 99.19% / 418 / non-hypermethylated
MIC189 / 0.42% / 99.23% / 387 / non-hypermethylated
MIC191 / 1.95% / 98.63% / 394 / non-hypermethylated
MIC218 / 35.87% / 98.46% / 505 / Hypermethylated
MIC224 / 57.85% / 98.83% / 389 / Hypermethylated
MIC228 / 0.41% / 99.15% / 463 / non-hypermethylated
MIC234 / 0.77% / 99.32% / 816 / non-hypermethylated
MJ2021 / 0.49% / 99.15% / 1970 / non-hypermethylated
SM95 / 0.70% / 99.45% / 9538 / non-hypermethylated

Table esm2: Complete results from BRCA1/2 mutation and BRCA1 promoter methylation screening from 131 unselected triple-negative breast cancer samples from A.C.Camargo Cancer Center

Sample ID / BRCA1/2 point mutation / Tissue screened / BRCA1 promoter methylation / Tissue screened / BRCA1 Copy Number Alteration (MLPA) / Tissue screened
5228 / no pathogenic mutation / 1 / unmethylated / 1 / na
17755 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 2
17791 / Germline VUS - BRCA1 c.2522G>A; (p.Arg841Gln) / 1; 2 / unmethylated / 1 / No CNA / 2
18030 / no pathogenic mutation / 1 / unmethylated / 1 / na
19064 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
19088 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
4956 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M7 / no pathogenic mutation / 1 / unmethylated / 1 / na
M15 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
M255 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M256 / Germline Pathogenic - BRCA1 c.1A>G; p.(Met1?) / 1; 2 / unmethylated / 1 / No CNA / 1
M257 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M259 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M260 / no pathogenic mutation / 1 / unmethylated / 1 / na
M261 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
M262 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
M263 / no pathogenic mutation / 1 / na / No CNA / 2
M264 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M265 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M266 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M267 / Germline Pathogenic - BRCA1 c.66dupA; p.(Glu23Argfs*18) / 1; 2 / unmethylated / 1 / No CNA / 1; 2
M268 / Germline VUS - BRCA1 c.3356C>G; (p.Thr1119Ser) / 1; 2 / unmethylated / 1 / No CNA / 1
M269 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M274 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M275 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
M276 / Germline Pathogenic – BRCA1 c.181T>G; p.(Cys61Gly) / 1; 3 / unmethylated / 1 / No CNA / 1
M277 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M278 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M280 / Germline Pathogenic - BRCA1 c.1123_1124delinsA; p.(Leu375Lysfs*19) / 1; 2 / unmethylated / 1 / No CNA / 2
M281 / Germline Pathogenic - BRCA2 c.5644_5647delTCAA; p.(Ser1882Lysfs*26) / 1; 2 / unmethylated / 1 / No CNA / 1
M282 / Germline Pathogenic - BRCA1 c.2405_2406delTG; p.(Val802Glufs*7) / 1; 2 / unmethylated / 1 / No CNA / 1
M283 / no pathogenic mutation / 1 / unmethylated / 1 / na
M284 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1; 2
M285 / Somatic Pathogenic - BRCA1 c.5503C>T; p.(Arg1835*) / 1; 2 / unmethylated / 1 / No CNA / 2
M286 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M287 / Germline Pathogenic - BRCA1 c.4183C>T; p.(Gln1395*) / 1; 2 / unmethylated / 1 / No CNA / 1
M288 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M290 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M291 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M292 / Germline Pathogenic - BRCA1 c.4096+1G>A; splice site donor / 1; 2 / unmethylated / 1 / No CNA / 1
M293 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1; 2
M298 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M299 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M300 / no pathogenic mutation / 1 / unmethylated / 1 / na
M302 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M303 / Germline Pathogenic - BRCA1 c.4484G>T; p.(Arg1495Met) / 1; 2 / unmethylated / 1 / na
M304 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
M305 / Germline Pathogenic - BRCA1 c.211A>G; p.(Arg71Gly) / 1 / unmethylated / 1 / na
M308 / no pathogenic mutation / 1 / unmethylated / 1 / na
M309 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1; 2
M310 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M311 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M312 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
M313 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
M314 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M315 / Germline Pathogenic - BRCA1 c.689_692delAGAC; p.(Glu230Glyfs*3) / 1; 2 / unmethylated / 1 / No CNA / 2
M316 / no pathogenic mutation / 1 / na / No CNA / 1
M319 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M32 / no pathogenic mutation / 1 / na / na
M320 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M321 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M322 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M323 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M324 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
M325 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M326 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M340 / no pathogenic mutation / 1 / unmethylated / 1 / na
M341 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M343 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M344 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M345 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M346 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M347 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M348 / Germline VUS - BRCA2 c.608C>A; (p.Thr203Asn) / 1; 3 / unmethylated / 1 / No CNA / 1
M349 / no pathogenic mutation / 1 / na / No CNA / 2
M350 / no pathogenic mutation / 1 / unmethylated / 1 / na
M351 / no pathogenic mutation / 1 / unmethylated / 1 / na
M352 / no pathogenic mutation / 1 / unmethylated / 1 / na
M355 / Germline Pathogenic – BRCA1 c.181T>G; p.(Cys61Gly) / 1; 2 / unmethylated / 1 / na
M356 / no pathogenic mutation / 1 / na / No CNA / 1
M357 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M358 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M360 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M361 / no pathogenic mutation / 1 / unmethylated / 1 / na
M362 / no pathogenic mutation / 1 / unmethylated / 1 / na
M363 / Somatic VUS - BRCA2 c.3224G>C; p.(Ser1075Thr) / 1; 2 / hyper-methylated / 1 / No CNA / 1
M364 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M365 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M366 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M367 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M368 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M369 / Germline Pathogenic – BRCA1 c.5266dupC; p.(Gln1756Profs*74) / 1 / unmethylated / 1 / No CNA / 1
VUS - BRCA2 c.9581C>A; p.(Pro3194Gln)
M370 / Germline VUS - BRCA1 c.5108A>G; p.(Tyr1703Cys) / 1; 2 / unmethylated / 1 / No CNA / 1
M371 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M372 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M373 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M374 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M376 / no pathogenic mutation / 1 / na / No CNA / 1
M377 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M378 / no pathogenic mutation / 1 / unmethylated / 1 / na
M379 / VUS - BRCA2 c.280C>T; p.(Pro94Ser) / 1 / hyper-methylated / 1 / na
M380 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M381 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M382 / no pathogenic mutation / 1 / na / na
M384 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
M385 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
M386 / VUS - BRCA2 c.9364G>A; p.(Ala3122Thr) / 1 / unmethylated / 1 / No CNA / 1
MIC134 / no pathogenic mutation / 1 / unmethylated / 1 / na
MIC137 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
MIC141 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
MIC142 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
MIC144 / Germline VUS - BRCA1 c.3823A>G; p.(Ile1275Val) / 1; 2 / hyper-methylated / 1 / No CNA / 1
MIC146 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
MIC175 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
MIC177 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
MIC180 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 2
MIC183 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 2
MIC185 / no pathogenic mutation / 1 / unmethylated / 1 / na
MIC189 / Germline Pathogenic - BRCA2 c.2701delC; p.(Ala902Leufs*2) / 1; 2 / unmethylated / 1 / No CNA / 1
MIC191 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 1
MIC20 / no pathogenic mutation / 1 / unmethylated / 1 / na
MIC21 / no pathogenic mutation / 1 / unmethylated / 1 / na
MIC218 / no pathogenic mutation / 1 / hyper-methylated / 1 / No CNA / 1
MIC224 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
MIC228 / no pathogenic mutation / 1 / unmethylated / 1 / No CNA / 2
MIC234 / Germline Pathogenic - BRCA1 c.188T>A; p.(Leu63*) / 1; 2 / unmethylated / 1 / No CNA / 2
MIC25 / no pathogenic mutation / 1 / unmethylated / 1 / na
MIC68 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
MIC82 / no pathogenic mutation / 1 / hyper-methylated / 1 / na
MJ2021 / Germline Pathogenic - BRCA1 c.181T>G; p.(Cys61Gly) / 1; 2 / unmethylated / 1 / No CNA / 2
SM95 / Germline Pathogenic - BRCA1 c.4287C>A; p.(Tyr1429*) / 1; 2 / unmethylated / 1 / No CNA / 2

na=not available; CNA=copy number alteration; 1=tumor DNA; 2=leukocyte DNA ,3=normal adjacent breast tissue DNA