Online Supplementary Material for Buchbinder et al.

Materials and Methods

CASE REPORT 1

Study Subjects

Blood samples were drawn from the subject after informed consent was obtained from the individual in this study, which was approved by the CHOC Children’s Hospital Institutional Review Board.

Whole Exome Sequencing

Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll gradient centrifugation (GE Healthcare: Piscataway NJ) and genomic DNA was isolated from PBMCs (Qiagen USA: Germantown MD). Exome sequencings were performed for the patients and family members at Beijing Genome Institute (BGI) and about 90-100 million paired-end reads were produced for each sample. All sequencing date were aligned to reference genome GRCh37/hg19 using BWA, and the output BAM files were run through the Genome Analysis Toolkit (GATK) for SNP and indel calling. VAAST (the Variant Annotation, Analysis and Search Tool) and in-house custom analysis pipeline were used for variant annotation, filtered and prioritized for disease causal variants.

RAG Activity

Rag1-/- pro-B abelson line (106/mL) with E-Bcl2 transgene were infected with virus containing pMX- INV, from which clones with single copy pMX-INV were selected and further infected with virus containing pBMN-RAG1-IRES-hCD2 with either wild type or mutant RAG1 protein (K86VfsX33, W522C and H612R). All the infections were carried out using a protocol to include <1 vector copy number.

Rag1-/- pro-B abelson cells with pMX-INV and pBMN-RAG1-IRES-hCD2 proviral integrants were isolated by magnetic bead sorting by human CD4 and human CD2 microbeads (Miltenyi Biotec GmbH, Germany) and analyzed by FACS for recombination-dependent expression of GFP upon treatment with 3M STI571(Novartis) for 96 hours to promote cell differentiation and VDJ recombination.

CASE REPORT 2

Study Subjects

Blood samples were drawn from the subject after informed consent was obtained from the individual in this study, which was approved by the University of Utah Institutional Review Board (IRB #00029386).

HaloPlex Capture and Illumina Sequencing

Two hundred and twenty five nanograms of genomic DNA were used for enrichment. Enrichment of genes was performed using Agilent’s HaloPlex target enrichment system (Agilent Technologies, Santa Clara, CA) containing custom capture probes. Gene targets were enriched according to the manufacturer’s instructions and a unique index (barcode) was introduced on each sample during the target enrichment protocol. The library from the individual described in this study was pooled with libraries from three other individuals and was sequenced on an Illumina MiSeq (San Diego, CA) using the MiSeq reagent kit v2 (300 cycles).

Sequence Data Analysis

FASTQ files were generated with the on board Illumina Control Software on the MiSeq instrument. Illumina adapter sequences and low quality bases from the 5’ end of each read in the FASTQ files were trimmed using TrimGalore and Cutadapt. Trimmed FASTQ files were aligned to the GRCh37/hg19 version of the human genome and variants were called using BWA, SamTools, and GATK. GATK was also used to annotate variants. The resulting Variant Call Format (VCF) file was used for subsequent filtering. Variants present in >2% of the population using the minor allele frequencies from the 5400 exomes dataset (E1) were removed and only variants that affect the protein (missense, nonsense, splicing) were analyzed further. A group of 27 additional samples, 26 of which also have a diagnosis of CVID were sequenced using the same method. Variants present in more than 5 individuals in this collection were removed in an effort to reduce common variants that may not be pathogenic. The RAG1 c.1566G>T mutation was covered with 2,701 reads and the alternate T was present in 48% of reads. The c.2689C>T mutation was covered with 4,704 reads and the alternate T was present in 52% of the reads.

Sanger Sequencing

The two mutations in the RAG1 gene were confirmed by Sanger sequencing using standard methods. Primers used for sequencing the c.1566G>T variant were Forward 5’ GTCAACACCTTCCTCAGC 3’ and Reverse 5’ CCATCAAAGCAGACACCAA 3’. Primers used for sequencing the c.2689C>T variant were Forward 5’ GAGGAAAGGAAAAGGTGGCAGG 3’ and Reverse 5’ccggaagcgcctaaacagtt 3’.

References

E1. NHLBI Exome Sequencing Project (ESP) Exome Variant Server. Available at: http://evs.gs.washington.edu/EVS/. Accessed July 13, 2013.

Table E1. Lymphocyte subsets in Case Report 2.

Age (year old) / 19 / 20 / 24 / 27
B cells / NT / 24L
(112-618/mL) / 92L
(117-620/mL) / NT
3.2L
(6.3-20.0%) / 2L
(5-23%) / 9
(6-23%) / <1L
(6-23%)
NK cells / NT / 69L
(80-662/mL) / 43L
(72-602/mL) / NT
9.9
(3.2-23.7%) / 6
(5-29%) / 4
(4-27%) / 4
(4-27%)
CD3 cells / NT / 988
(684-2170/mL) / 949
(710-2300/mL) / NT
86.4
(62.0-88.0%) / 90H
(58-87%) / 87
(58-87%) / 96H
(58-87%)
CD8 cells / NT / 496
(138-858/mL) / 455
(183-1160/mL) / NT
48.1H
(11.2-37.3%) / 46H
(8-44%) / 41
(12-45%) / 39
(12-45%)
CD4 cells / NT / 415
(381-1469/mL) / 473
(370-1540/mL) / NT
35.3
(35.3-61.1%) / 38
(32-62%) / 43
(32-62%) / 42
(32-62%)
CD4+CD45RA+ / NT / 33
(32-961/mL) / 22L
(165-1030/mL) / NT
NT / 3L
(4-48%) / 2L
(3-38%) / NT
CD4+CD45RO+ / NT / 402
(108-795/mL) / 489
(230-1290/mL) / NT
NT / 36H
(10-35%) / 41
(16-46%) / NT

For each cell type, absolute numbers of cells were measured in cells/mL (top row) and the percentage of cells relative to total were calculated (bottom row). Reference ranges are age and laboratory specific. NT = not tested; L = values are lower than reference range; H = values are higher than reference range.

Online Figure 1. Identification of RAG1 mutations by Haloplex Enrichment and Illumina Sequencing in Case Report 2.

A, Screenshot from the Integrative Genomics Viewer showing the RAG1 c.1566G>T/p.W522C and RAG1 c.2689C>T/p.R897X variants (Reference: NM_000448). Gray bars show individual reads and red T’s show the position of the variant in each individual read. Red and brown box shows the position of the c.1566G>T variant and the red and blue box shows the position of the c.2689C>T variant. B, Sanger sequencing verification of the c.1566G>T and c.2689C>T variants.

1