Supplemental Clinical Assessment and Phenotype the Proband Is a 4.5-Year-Old Female. She

Supplemental Clinical Assessment and Phenotype
The proband is a 4.5-year-old female. She was born to a G1P0 woman after an induction of labour post-dates following a reportedly normal pregnancy except an amniotic fluid leak prior to delivery. She weighed 2.87 kg at birth and was noted to be microcephalic. A cranial ultrasound was performed at the delivering hospital to investigate the microcephaly and identified bilateral calcifications. At 5 weeks of ageshe was admitted to a tertiary children’s hospital with severe microcephaly and failure to thrive (occipital-frontal circumference: 32.5 (<3rd percentile), weight: 2.92 (<3rd percentile), length: 51.5 cm (10th percentile). A computed tomography (CT) scan of the brain revealed bilateral, symmetrical calcifications involving the ventrolateral thalami and asymmetrical calcifications in the basal ganglia. There was bilateral subcortical calcification with possibly some involvement of the cortex. The cerebellum was spared. The lateral ventricles were slightly enlarged. A follow-up head magnetic resonance imaging (MRI) identified the same pattern of calcification and there was no evidence of a migrational defect. A follow-up CT scan performed three months later identified progression of the calcifications of the thalami, basal ganglia and subcortical white matter.

During the admission with failure to thrive, she was found to have hypercalcemia (peak calcium= 3.01 mmol/l) and hypernatremia (peak sodium = 161 mmol/l). Renal imaging identified small echogenic kidneys with size asymmetry with the right being below range for age/weight and the left being low normal in size with pelviectasis. The hypercalcemia was secondary to renal dysfunction with exclusion of other secondary causes inclusive of appropriate suppression of parathyroid hormone release. Her clinical renal profile confirmed obligate polyuria with inadequate urinary concentration. This caused intermittent hypernatremia and hypercalcemia provoked by illnesses when there was inadequate fluid provision or secondary fluid loss. The hypercalcemia was responsive to rehydration inclusive of solute loading and furosemide. She was supplemented with sodium phosphate and sodium bicarbonate to address hypophosphatemia and renal tubular acidosis. Tube feedings were implemented to ensure adequate fluid intake of 150% of maintenance water requirements. Follow-up renal ultrasounds continued to show asymmetry of kidney size and evolution of bilateral echogenic changes consistent with cortical calcifications. Her initial diethylene-triamine-penta-acetic acid (DTPA) renal scan was done at 6 weeks of age and confirmed asymmetry of function (right=36%, left =64%) and significant reduction of glomerular filtration rate (GFR) at 18.0 ml/min/1.73 m2 confirming chronic kidney disease (CKD) stage 4 (CKD stage 4 = GFR of 15-30 ml/min/1.73 m2). Three annual follow-up DTPA renal scans continue to confirm stable CKD stage 4 and renal asymmetry with the most recent done at 4 years 4 months with GFR= 16.25 ml/min/1.73m2and the right kidney contributing 40% versus 60% contribution of the left kidney. The renal dysfunction was addressed with extra free water via G-tube feeding to improve peripheral perfusion and allow for home based care duringintercurrent illnesses.

The patient developed seizures at two months of age. Her parents initially noted lip smacking and twitching. At three months of age she presented to her community hospital with increasing multifocal clonic seizures, and was transferred to the tertiary care children’s hospital with status epilepticus. Seizures have been well controlled with phenobarbital. She has profound developmental impairment, cerebral palsy and failure to thrive. She is nonverbal and largely non-communicative. She has no independent mobility and no independent use of her hands. She is fed exclusively through a gastrostomy tube. She has hip displacement and remains significantly less than the third percentile for all growth parameters. She is followed by ophthalmology for cortical visual impairment with nystagmus and has only sight response to light. There is no evidence of liver or cardiac dysfunction and no evidence of thrombocytopenia or involvement of other organs.

Investigations were not suggestive of a TORCH infection, alpha-interferon levels in CSF were normal, and no mutations were discovered on sequencing of the TREX1, RNASEH2B, RNASEH2C and RNASEH2A genes associated with Aicardi Goutieres Syndrome. A microarray analysis on the DNA of this patient did not identify any clinically significant deletions or duplications.
Review of the proband’s family history revealed a female paternal first cousin with a seizure disorder, cerebral palsy, global developmental delay and brain calcifications. This child was born at term to a 21-year-old G1P0 following a pregnancy complicated by a concealed placental abruption. Her growth parameters at birth were 3310g (25th-50th percentile), length of 50.5 cm (50th-75th percentile) and a head circumference of 32 cm (3rd percentile). The child developed neonatal seizures consisting of bicycling movements at 10 hours of age. A head CT scan revealed underdevelopment of the frontal lobes and a small region possibly suspicious for polymicrogyria in the perisylvian region of the left frontal lobe. There was dense calcification in the subcortical white matter of the bilateral frontal lobes, the lentiform nuclei and the anterior thalami. TORCH testing was normal. A head MRI at 2 years revealed a markedly dilated ventricular system with progressive cortical and sub-cortical brain atrophy. There was the appearance of linear subcortical, thalami and lentiform nuclei calcifications in a band-like pattern.

This girl also has significant renal dysfunction. Her index renal presentation was at age 6 year 4 months with acute renal failure responsive to intravenous fluid replacement during intercurrent illness. Subsequent evaluation confirmed baseline hypernatremia (peak sodium = 168 mmol/l). Her renal ultrasound confirmed small echodense kidneys in the typical location without hydronephrosis or structural anomalies. She was investigated and found to have obligate polyuria and increased fluid needs with normalization of her sodium with provision of adequate fluid intake of 175% of maintenance water requirements. Her initial DTPA renal scan was done at 6 year 5 months and confirmed asymmetry of function (right = 38%; left = 62%%) and significant reduction of GFR at 34.3 ml/min/1.73 m2 CKD stage 3 (CKD stage 3 = GFR of 30-60 ml/min/1.73 m2).

At 6.5 years of age, this child is wheelchair dependent with no head or trunk control, cannot manipulate toys and is non-verbal. Seizures are well controlled on carbamazepine. She is orally fed fluids and pureed foods but has required a gastrostomy tube for insufficient oral intake. She has constipation. She has had bilateral hip displacement requiring surgery. Her growth is significantly below the 3rd percentile but following her own curve. Her head circumference is significantly below the 2nd percentile and continuing to fall further off the curve. She is followed by ophthalmology for exotropia and significant cortical visual impairment with a normal retinal exam. There is no evidence of liver or cardiac dysfunction and no evidence of thrombocytopenia or involvement of other organs.

Figure S1: Discriminating nucleotide (DN) distinguishes the OCLN gene from the pseudogene(s) allowing for differentiation between the two pcr amplicons by Direct Sanger sequencing.A:A heterozygous call in section F39/R39 using DN39A suggests the amplification of both the OCLN gene and the pseudogene(s) in both control and affected samples. B:A homozygous call representing only the pseudogene(s) in the affected samples in F43/R43 amplicons using DN43A. A heterozygous call at DN43A in the control samples represents both the OCLN gene and the pseudogene(s).

Table S1. MLPA custom probes designed for this study

Probe / Sequence / Size
OCLN_E02_L / GGGTTCCCTAAGGGTTGGACTGACCATTGACAATCAGCCATGTCATCCAG / 107
OCLN_E02_R / GCCTCTTGAAAGTCCACCTCCTTACAGGCCTGATTCTAGATTGGATCTTGCTGGCAC
OCLN_E07_L / GGGTTCCCTAAGGGTTGGACCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAG / 123
OCLN_E07_R / GAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACtcTCTAGATTGGATCTTGCTGGCAC
OCLN_E08_L / GGGTTCCCTAAGGGTTGGATGTGTCTGTCGTTAATAGGCTGCTGCTGATGAATAC / 117
OCLN_E08_R / AATAGACTGAAGCAAGTGAAGGGAGTAAGTATCCGAGtcTCTAGATTGGATCTTGCTGGCAC
OCLN_E09**_L / GGGTTCCCTAAGGGTTGGAGTCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAG / 137
OCLN_E09**_R / AGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATtacgacacatTCTAGATTGGATCTTGCTGGCAC
OCLN_3UTR**_L / GGGTTCCCTAAGGGTTGGAGAAGCCAAACCTCTGTGAGCATCACAAA / 103
OCLN_3UTR**_R / GTTTTGGTTGCTTTAACATCATCAGTATTGAAGTCTAGATTGGATCTTGCTGGCAC
SAG_L / GGGTTCCCTAAGGGTTGGAGAAGACCAGCAAGTCCGAACCGAACCATGTTATCTTCAAGAAG / 128
SAG_R / ATCTCCCGGGACAAATCGGTGAGTGGTGCACAAGTGAGTGATTTCTAGATTGGATCTTGCTGGCAC

** Represents probes that target discriminating nucleotides. Highlighted nucleotides are the discriminating nucleotides found at the 3’end of the 5’(L) primer. Bold nucleotides are part of the hybridization and the stuffer sequence

Table S2: Primers used in this study

Primer name / Primer sequence / Location OCLN gene / Location pseudogene II / Location pseudogene I
OCLN_F39 / GCCATTTTTCAGTTGAGGTGA / 68846483 / 70373067
OCLN_R39 / TTCCTAAAAGAACAATCTCGGATA / 68847418 / 70372132
OCLN_F40 / TCAAAGTGTATAACATGGTGAATTTT / 68847580 / 70371970
OCLN_R40 / TGCAATATTTTTAAATGCCAAA / 68848558 / 70370992
OCLN_F41 / TGGCCGGTTGATTAATTTTT / 68848458 / 70371092
OCLN_R41 / GCTCTTTAACTGCTTGCAATGAT / 68849422 / 70370128
OCLN_F42 / GCTGATGCCAAGTTGTTTGA / 68849502 / 70370048
OCLN_R42 / AGCACAGCATCCAAAGGAGT / 68850478 / 69705625 / 70369074
OCLN_F43 / TGCTGTGCTGGTTAGTCGTT / 68850489 / 69705636 / 70369063
OCLN_R43 / TTCAATTTGCAGAAATAAATCAGTG / 68851462 / 69706608 / 70368090
OCLN_F44 / GTGCCCGGCCTATAATTTTT / 68851386 / 69706532 / 70368166
OCLN_R44 / ATCCCTTGTTTTGCCACTTG / 68852354 / 69707500 / 70367198
OCLN_F45 / TGTTGACTTTGTTAATGGATTGG / 68852420 / 69707566 / 70367132
OCLN_R45 / GAATGCCAATCCTGCATTCT / 68853398 / 69708545 / 70366153
OCLN_F46 / GAATGCAGGATTGGCATTCT / 68853399 / 69708546 / 70366152
OCLN_R46 / CAAGCAAGTCACAACCCAAG / 68854379 / 69709526 / 70365172
OCLN_F47 / TGGGTTGTGACTTGCTTGAG / 68854381 / 69709528 / 70365170
OCLN_R47 / GAGGGCAGGACTTCGAGAC / 68855341 / 69710488 / 70364210
OCLN_F48 / GCCCGGCTAATGTTTTTGTA / 68855282 / 69710429 / 70364269
OCLN_R48 / GCCGCTAGAAGGACTCTCAG / 68856046 / 69711193 / 70363505