Supplementary material2
Table S1. Primer sequences used to assay 20genes by qRT-PCRverification.
Gene ID / Primer sequence (5'to 3') / Tm (°C) / Product size(bp)Unigene2665_L / Forward / CTCACTCTCACACACCCACAA / 59.8 / 99
Reverse / GACCATTTGCCTGATTCTCAC / 59.5
Unigene4881_L / Forward / CAAGAAGGGTAGTGACGGTGA / 60.2 / 150
Reverse / GCTTCCAAAACCGAAACAATC / 60.8
Unigene5160_L / Forward / CTTGTTTGCCAGGTTCTTGAG / 59.9 / 217
Reverse / CAGCAGTGTCCCCTTTGAATA / 60.1
Unigene8786_L / Forward / AATACCGAAAATGACCCCACT / 59.6 / 204
Reverse / GTCGCCAAAAATCTCACCTT / 59.2
Unigene9165_L / Forward / CCTCCAAAAGAGCATAGACCAC / 60.1 / 82
Reverse / GAAAAATCCCCCATTCAACAT / 59.9
Unigene14408_L / Forward / AACGGAGTTAGAGTTGCCGATA / 60.1 / 119
Reverse / CAGAAAAGCAGAGCGGGTAT / 59.5
Unigene17315_L / Forward / GATGCTAAAAATTCGGCGTACT / 59.7 / 104
Reverse / TCAAGGGAGAAAAATCCTACTGA / 59.3
Unigene22730_L / Forward / CACCCTCCAATCTCATCATTTC / 60.7 / 159
Reverse / ATCGTTCGGTCCCATCATTA / 60.2
Unigene30179_L / Forward / CTCGCTGGGATCTTGGTTTAT / 60.5 / 98
Reverse / CCTGTGCTTTCCATTCACAAT / 60.0
Unigene49002_L / Forward / GGGAAGGATGGATTGATTTGT / 60.0 / 90
Reverse / TCCAACAGTGAAGGAAGTCTAGTG / 59.8
Unigene52323_L / Forward / TTTTCCGGTCGGTGTCTC / 59.6 / 98
Reverse / ATGTCTGAGGACTTGCTCTGC / 59.6
Unigene62235_L / Forward / GGAGAAGAGGAGGCATAAGGTT / 60.1 / 89
Reverse / TACATCACCAGCACCACCAA / 61.0
Unigene77797_L / Forward / CCAAGGTGACAGAAAAAGCTG / 59.9 / 82
Reverse / TCAAAAGCCATGACAAGTTCC / 60.1
Unigene79183_L / Forward / ACGAGCCCTCACCAATTATCT / 60.0 / 139
Reverse / CATTTGTTCCTTCCCTTCCAC / 60.7
Unigene81812_L / Forward / CCTCATTTACTCAGCATTTCCA / 59.2 / 211
Reverse / AGCATTTCGTGGCTTCTCATAC / 60.6
Unigene89562_L / Forward / GCACGCCAGAAACTACTCAAC / 59.9 / 227
Reverse / CCATCCATCACCATAAATTGC / 60.0
Unigene90301_L / Forward / CCTCTCGGTGGAAAACCTATT / 59.5 / 193
Reverse / CCATTGACTGACCATAAGCATC / 59.5
Unigene91402_L / Forward / GTGCTGCCTGATGGTTCTTTA / 60.3 / 247
Reverse / ATCCCTTTCTTGAGGTTTCCAG / 60.8
Unigene91169_L / Forward / TCGGAGCCAAATAGTCCAAAT / 60.8 / 236
Reverse / TCCCATTCACCAAGAACTGAT / 59.4
Unigene93656_L / Forward / ATAAGGGGAAAGGTTCAATGC / 59.3 / 115
Reverse / ATGGCAAAGTAGGAAAACGAAG / 59.7
18S / Forward / GAGCTAATACGTGCAACAAACC / 60.8 / 166
Reverse / CGAAAGTTGATAGGGCAGAAAT / 59.4
Table S2. Primer sequences used to assay 12 gene expression patterns by qRT-PCR method.
Gene ID / Primer sequence (5'to 3') / Tm (°C) / Product size(bp)Unigene1752_L / Forward / TCGGGTGTCTTTACTGGACTC / 59.2 / 144
Reverse / AAGCCTGATGTAGCCGTTTTC / 60.6
Unigene2665_L / Forward / CTCACTCTCACACACCCACAA / 59.8 / 99
Reverse / GACCATTTGCCTGATTCTCAC / 59.5
Unigene4881_L / Forward / GGGAAGGATGGATTGATTTGT / 60.0 / 150
Reverse / TCCAACAGTGAAGGAAGTCTAGTG / 59.8
Unigene8786_L / Forward / AACGGAGTTAGAGTTGCCGATA / 60.1 / 204
Reverse / CAGAAAAGCAGAGCGGGTAT / 59.5
Unigene14408_L / Forward / AACGGAGTTAGAGTTGCCGATA / 60.1 / 119
Reverse / CAGAAAAGCAGAGCGGGTAT / 59.5
Unigene39914_L / Forward / TGCAAGATCGACAGTTCCAG / 60.0 / 149
Reverse / CTGACTTTGCCTCGTCGTATG / 60.8
Unigene52323_L / Forward / TTTTCCGGTCGGTGTCTC / 59.6 / 98
Reverse / ATGTCTGAGGACTTGCTCTGC / 59.6
Unigene80649_L / Forward / GGAGGAACATCATTGGTCAGA / 59.9 / 101
Reverse / AGTAGCATCAGAACCCCTAAGC / 59.0
Unigene88324_L / Forward / CCAAGGTGACAGAAAAAGCTG / 59.9 / 187
Reverse / TCAAAAGCCATGACAAGTTCC / 60.1
Unigene89562_L / Forward / CAACCAAAGAAAACGGCACT / 60.1 / 227
Reverse / CCTGGAAACGGAACTAATCGT / 60.4
Unigene90807_L / Forward / CACTCTGACCTCGTTCCAATC / 59.7 / 146
Reverse / GCAGCACTCAACCTGACATTT / 60.3
Unigene91544_L / Forward / TTCCCGAGTTTTTAGTTCTTCG / 59.8 / 90
Reverse / CAATCTTTTGTCCTCCTTCTGG / 60.1
18S / Forward / GAGCTAATACGTGCAACAAACC / 58.8 / 166
Reverse / CGAAAGTTGATAGGGCAGAAAT / 59.6
Table S3. Sequencing statistics of R. glutinosaleaf transcriptome library.
Total Reads / Total Nucleotides (nt) / Q20 percentage / N percentage / GC percentage41,400,002 / 3,726,000,180 / 94.54% / 0.00% / 46.58%
Table S4. Length distribution of assembled contigs, scaffolds and unigenes for R. glutinosa leaf transcriptome.
Length(bp) / Contigs / Scaffolds / UnigenesNumber / Percentage / Number / Percentage / Number / Percentage
75-100 / 349,090 / 65.75 / 0 / 0.00 / 0 / 0.00
100-500 / 169,244 / 31.88 / 140,812 / 89.59 / 78,290 / 82.81
500-1000 / 9,959 / 1.88 / 11,784 / 7.50 / 11,696 / 12.37
1000-1500 / 1,844 / 0.35 / 2,782 / 1.77 / 2,769 / 2.93
1500-2000 / 513 / 0.09 / 1,055 / 0.67 / 1,046 / 1.11
≥2000 / 300 / 0.05 / 749 / 0.48 / 743 / 0.79
Total number / 530,950 / 100.00 / 157,812 / 100.00 / 94,544 / 100.00
Total Nucleotides / 72,965,314 / 42,519,022 / 34,806,569
N50 / 122 / 330 / 420
Mean / 137 / 271 / 368
Table S5. The summary of annotated CDS non-redundant consensus sequences.
Database / Number of annotated sequences / Percentage of annotated sequencesNR / 51,155 / 93.88
Swissprot / 30,890 / 56.69
GO / 15,464 / 28.38
COG / 12,936 / 23.74
KEGG / 21,769 / 39.95
Table S6. KEGG pathway annotation of differentially transcribed CD-containing sequences in the transcriptome library of R. glutinosaleaves.
(Percentage) / Pathway ID
1 / Ribosome / 333 (1.57%) / ko03010
2 / Carotenoid biosynthesis / 190 (0.89%) / ko00906
3 / Amino sugar and nucleotide sugar metabolism / 342 (1.61%) / ko00520
4 / Pentose and glucuronate interconversions / 184 (0.87%) / ko00040
5 / Glycosphingolipid biosynthesis - globo series / 31 (0.15%) / ko00603
6 / Biosynthesis of secondary metabolites / 3004 (14.13%) / ko01110
7 / Porphyrin and chlorophyll metabolism / 183 (0.86%) / ko00860
8 / Fatty acid biosynthesis / 122 (0.57%) / ko00061
9 / Linoleic acid metabolism / 134 (0.63%) / ko00591
10 / Diterpenoid biosynthesis / 106 (0.5%) / ko00904
11 / Circadian rhythm - plant / 246 (1.16%) / ko04712
12 / DNA replication / 143 (0.67%) / ko03030
13 / Spliceosome / 695 (3.27%) / ko03040
14 / Protein export / 113 (0.53%) / ko03060
15 / Biosynthesis of unsaturated fatty acids / 149 (0.7%) / ko01040
16 / Metabolic pathways / 5156 (24.25%) / ko01100
17 / SNARE interactions in vesicular transport / 86 (0.4%) / ko04130
18 / Lysine degradation / 123 (0.58%) / ko00310
19 / Ubiquinone and other terpenoid-quinone biosynthesis / 92 (0.43%) / ko00130
20 / Polyketide sugar unit biosynthesis / 30 (0.14%) / ko00523
21 / alpha-Linolenic acid metabolism / 206 (0.97%) / ko00592
22 / Flavone and flavonol biosynthesis / 97 (0.46%) / ko00944
23 / Peroxisome / 328 (1.54%) / ko04146
24 / Cysteine and methionine metabolism / 337 (1.58%) / ko00270
25 / Flavonoid biosynthesis / 298 (1.4%) / ko00941
26 / RNA polymerase / 103 (0.48%) / ko03020
27 / Butanoate metabolism / 113 (0.53%) / ko00650
28 / Vitamin B6 metabolism / 12 (0.06%) / ko00750
29 / Alanine, aspartate and glutamate metabolism / 158 (0.74%) / ko00250
30 / Steroid biosynthesis / 80 (0.38%) / ko00100
31 / Purine metabolism / 412 (1.94%) / ko00230
32 / Photosynthesis - antenna proteins / 13 (0.06%) / ko00196
33 / Fatty acid metabolism / 209 (0.98%) / ko00071
34 / Arachidonic acid metabolism / 49 (0.23%) / ko00590
35 / Regulation of autophagy / 89 (0.42%) / ko04140
36 / Phagosome / 257 (1.21%) / ko04145
37 / Pyrimidine metabolism / 301 (1.42%) / ko00240
38 / Glycosaminoglycan degradation / 51 (0.24%) / ko00531
39 / Pantothenate and CoA biosynthesis / 57 (0.27%) / ko00770
40 / Oxidative phosphorylation / 328 (1.54%) / ko00190
41 / Phenylalanine, tyrosine and tryptophan biosynthesis / 107 (0.5%) / ko00400
42 / Fructose and mannose metabolism / 155 (0.73%) / ko00051
43 / Non-homologous end-joining / 25 (0.12%) / ko03450
44 / Valine, leucine and isoleucine biosynthesis / 115 (0.54%) / ko00290
45 / C5-Branched dibasic acid metabolism / 27 (0.13%) / ko00660
46 / Aminoacyl-tRNA biosynthesis / 209 (0.98%) / ko00970
47 / Glycerolipid metabolism / 210 (0.99%) / ko00561
48 / Glycosphingolipid biosynthesis - ganglio series / 30 (0.14%) / ko00604
49 / Glucosinolate biosynthesis / 76 (0.36%) / ko00966
50 / Glutathione metabolism / 171 (0.8%) / ko00480
51 / Starch and sucrose metabolism / 753 (3.54%) / ko00500
52 / Riboflavin metabolism / 32 (0.15%) / ko00740
53 / Caffeine metabolism / 33 (0.16%) / ko00232
54 / Folate biosynthesis / 34 (0.16%) / ko00790
55 / Pentose phosphate pathway / 131 (0.62%) / ko00030
56 / Stilbenoid, diarylheptanoid and gingerol biosynthesis / 375 (1.76%) / ko00945
57 / Photosynthesis / 85 (0.4%) / ko00195
58 / Indole alkaloid biosynthesis / 36 (0.17%) / ko00901
59 / Proteasome / 187 (0.88%) / ko03050
60 / Cyanoamino acid metabolism / 241 (1.13%) / ko00460
61 / Selenoamino acid metabolism / 96 (0.45%) / ko00450
62 / One carbon pool by folate / 44 (0.21%) / ko00670
63 / Mismatch repair / 100 (0.47%) / ko03430
64 / Protein processing in endoplasmic reticulum / 669 (3.15%) / ko04141
65 / Limonene and pinene degradation / 369 (1.74%) / ko00903
66 / Nicotinate and nicotinamide metabolism / 49 (0.23%) / ko00760
67 / Zeatin biosynthesis / 275 (1.29%) / ko00908
68 / Nitrogen metabolism / 168 (0.79%) / ko00910
69 / Phosphatidylinositol signaling system / 238 (1.12%) / ko04070
70 / Sphingolipid metabolism / 127 (0.6%) / ko00600
71 / Sulfur metabolism / 67 (0.32%) / ko00920
72 / Base excision repair / 131 (0.62%) / ko03410
73 / Galactose metabolism / 257 (1.21%) / ko00052
74 / Terpenoid backbone biosynthesis / 260 (1.22%) / ko00900
75 / Homologous recombination / 140 (0.66%) / ko03440
76 / Valine, leucine and isoleucine degradation / 140 (0.66%) / ko00280
77 / Phenylalanine metabolism / 207 (0.97%) / ko00360
78 / Benzoxazinoid biosynthesis / 81 (0.38%) / ko00402
79 / Tryptophan metabolism / 213 (1%) / ko00380
80 / RNA degradation / 275 (1.29%) / ko03018
81 / Inositol phosphate metabolism / 215 (1.01%) / ko00562
82 / Glycine, serine and threonine metabolism / 157 (0.74%) / ko00260
83 / Glyoxylate and dicarboxylate metabolism / 87 (0.41%) / ko00630
84 / Glycolysis / Gluconeogenesis / 361 (1.7%) / ko00010
85 / Phenylpropanoid biosynthesis / 545 (2.56%) / ko00940
86 / Tyrosine metabolism / 109 (0.51%) / ko00350
87 / Basal transcription factors / 112 (0.53%) / ko03022
88 / Other glycan degradation / 120 (0.56%) / ko00511
89 / Nucleotide excision repair / 223 (1.05%) / ko03420
90 / Carbon fixation in photosynthetic organisms / 224 (1.05%) / ko00710
91 / Glycerophospholipid metabolism / 240 (1.13%) / ko00564
92 / Ubiquitin mediated proteolysis / 389 (1.83%) / ko04120
93 / Ascorbate and aldarate metabolism / 170 (0.8%) / ko00053
94 / ABC transporters / 263 (1.24%) / ko02010
95 / Arginine and proline metabolism / 208 (0.98%) / ko00330
96 / Plant-pathogen interaction / 1808 (8.5%) / ko04626
97 / Endocytosis / 356 (1.67%) / ko04144
Table S7. The distribution of the experimental tags sequenced from the two libraries.
Tag Class / L1 distinct tags / L2 distinct tagsNumber / Percentage(%) / Number / Percentage(%)
Raw data / 377,200 / 100.00 / 361,659 / 100.00
Tags containing N / 11,274 / 2.99 / 11,478 / 3.17
Adaptors / 729 / 0.19 / 789 / 0.22
Tag copy num <2 / 203,899 / 54.06 / 200,102 / 55.33
Clean tag / 161,298 / 42.76 / 149,290 / 41.28
Copy num >=2 / 161,298 / 100.00 / 149,290 / 100.00
Copy num [2,5] / 89,072 / 55.22 / 80,324 / 53.80
Copy num [6,10] / 22,842 / 14.16 / 21,500 / 14.40
Copy num [11,20] / 17,012 / 10.55 / 16,130 / 10.80
Copy num [21,50] / 15,574 / 9.66 / 14,870 / 9.96
Copy num [51,100] / 16,798 / 10.41 / 7,322 / 4.90
Copy num >100 / 9,213 / 5.71 / 9,144 / 6.12
Table S8. Statistics of reference genes of DGE analysis.
Gene class / NumberAll genes / 94,544
Genes With CATG Site (percentage) / 60,574(62.41%)
Table S9. Up-regulated(log2 Ratio(L2/L1) >10)genes inthe L2 library
Gene ID / RawIntensity-L1 / RawIntensity-L2 / TPM-L1 / TPM-L2 / log2Ratio(L2/L1) / P-ValueUnigene1799_L / 0.00 / 1723.00 / 0.01 / 290.72 / 14.83 / 0.00
Unigene35185_L / 0.00 / 1049.00 / 0.01 / 177.00 / 14.11 / 0.00
Unigene334_L / 0.00 / 814.00 / 0.01 / 137.34 / 13.75 / 0.00
Unigene36274_L / 0.00 / 612.00 / 0.01 / 103.26 / 13.33 / 0.00
Unigene29520_L / 0.00 / 578.00 / 0.01 / 97.52 / 13.25 / 0.00
Unigene33344_L / 0.00 / 511.00 / 0.01 / 86.22 / 13.07 / 0.00
Unigene16441_L / 0.00 / 338.00 / 0.01 / 57.03 / 12.48 / 0.00
Unigene8681_L / 0.00 / 256.00 / 0.01 / 43.19 / 12.08 / 0.00
Unigene60174_L / 0.00 / 179.00 / 0.01 / 30.20 / 11.56 / 0.00
Unigene57407_L / 0.00 / 172.00 / 0.01 / 29.02 / 11.50 / 0.00
Unigene37415_L / 0.00 / 161.00 / 0.01 / 27.17 / 11.41 / 0.00
Unigene41774_L / 0.00 / 133.00 / 0.01 / 22.44 / 11.13 / 0.00
Unigene48999_L / 0.00 / 130.00 / 0.01 / 21.93 / 11.10 / 0.00
Unigene19402_L / 0.00 / 130.00 / 0.01 / 21.93 / 11.10 / 0.00
Unigene10622_L / 0.00 / 126.00 / 0.01 / 21.26 / 11.05 / 0.00
Unigene14858_L / 0.00 / 124.00 / 0.01 / 20.92 / 11.03 / 0.00
Unigene89459_L / 0.00 / 115.00 / 0.01 / 19.40 / 10.92 / 0.00
Unigene11721_L / 0.00 / 99.00 / 0.01 / 16.70 / 10.71 / 0.00
Unigene49419_L / 0.00 / 84.00 / 0.01 / 14.17 / 10.47 / 0.00
Unigene4435_L / 0.00 / 82.00 / 0.01 / 13.84 / 10.43 / 0.00
Unigene89322_L / 0.00 / 80.00 / 0.01 / 13.50 / 10.40 / 0.00
Unigene7644_L / 0.00 / 77.00 / 0.01 / 12.99 / 10.34 / 0.00
Unigene38084_L / 0.00 / 76.00 / 0.01 / 12.82 / 10.32 / 0.00
Unigene67627_L / 0.00 / 75.00 / 0.01 / 12.65 / 10.30 / 0.00
Unigene47343_L / 0.00 / 75.00 / 0.01 / 12.65 / 10.30 / 0.00
Unigene60993_L / 0.00 / 74.00 / 0.01 / 12.49 / 10.29 / 0.00
Unigene18911_L / 0.00 / 70.00 / 0.01 / 11.81 / 10.21 / 0.00
Unigene56632_L / 0.00 / 69.00 / 0.01 / 11.64 / 10.18 / 0.00
Unigene4871_L / 0.00 / 67.00 / 0.01 / 11.30 / 10.14 / 0.00
Unigene19521_L / 0.00 / 67.00 / 0.01 / 11.30 / 10.14 / 0.00
Unigene9126_L / 0.00 / 65.00 / 0.01 / 10.97 / 10.10 / 0.00
Unigene17315_L / 0.00 / 62.00 / 0.01 / 10.46 / 10.03 / 0.00
Unigene81417_L / 0.00 / 62.00 / 0.01 / 10.46 / 10.03 / 0.00
Table S10. Down-regulated (log2 Ratio(L2/L1)﹤-10) genes inthe L2 library.
Gene ID / RawIntensity-L1 / RawIntensity-L2 / TPM-L1 / TPM-L2 / log2Ratio(L2/L1) / P-ValueUnigene46796_L / 811 / 0 / 140.06 / 0.01 / -13.77 / 0.00
Unigene34993_L / 495 / 0 / 85.49 / 0.01 / -13.06 / 0.00
Unigene26338_L / 383 / 0 / 66.14 / 0.01 / -12.69 / 0.00
Unigene8175_L / 250 / 0 / 43.17 / 0.01 / -12.08 / 0.00
Unigene67394_L / 242 / 0 / 41.79 / 0.01 / -12.03 / 0.00
Unigene88837_L / 231 / 0 / 39.89 / 0.01 / -11.96 / 0.00
Unigene20503_L / 219 / 0 / 37.82 / 0.01 / -11.88 / 0.00
Unigene54295_L / 152 / 0 / 26.25 / 0.01 / -11.36 / 0.00
Unigene66789_L / 127 / 0 / 21.93 / 0.01 / -11.10 / 0.00
Unigene85829_L / 119 / 0 / 20.55 / 0.01 / -11.00 / 0.00
Unigene10109_L / 117 / 0 / 20.21 / 0.01 / -10.98 / 0.00
Unigene29255_L / 109 / 0 / 18.82 / 0.01 / -10.88 / 0.00
Unigene65718_L / 106 / 0 / 18.31 / 0.01 / -10.84 / 0.00
Unigene62235_L / 99 / 0 / 17.1 / 0.01 / -10.74 / 0.00
Unigene22212_L / 95 / 0 / 16.41 / 0.01 / -10.68 / 0.00
Unigene58338_L / 85 / 0 / 14.68 / 0.01 / -10.52 / 0.00
Unigene91549_L / 85 / 0 / 14.68 / 0.01 / -10.52 / 0.00
Unigene77239_L / 80 / 0 / 13.82 / 0.01 / -10.43 / 0.00
Unigene41922_L / 67 / 0 / 11.57 / 0.01 / -10.18 / 0.00
Unigene17969_L / 66 / 0 / 11.4 / 0.01 / -10.15 / 0.00
Unigene11232_L / 61 / 0 / 10.53 / 0.01 / -10.04 / 0.00
Unigene4540_L / 61 / 0 / 10.53 / 0.01 / -10.04 / 0.00
Unigene22250_L / 60 / 0 / 10.36 / 0.01 / -10.02 / 0.00
Table S11. NR annotation of differentially expressed genes in the L1 and L2 libraries.
Gene Class / Annotated genes / Unknown (unannotated) genesCount / Percentage / Count / Percentage
Up-regulated / 154 / 15.51% / 449 / 29.38%
L2 specific expressed / 26 / 2.62% / 122 / 7.98%
Down-regulated / 839 / 84.49% / 512 / 33.51%
L2 closed / 94 / 9.47% / 73 / 4.78%
Total / 993 / 100.00% / 1,528 / 100.00%
Table S12. Functional assignment of 115 genes highly differentially transcribed in the L2 Library.
Gene ID / Fold change (L2/L1) / GO Category / Blast nrComponent / Function / Process
Response to stimulus
Unigene4881_L / 9.4 / - / - / - / Avr9/Cf-9 rapidly elicited protein 180
Unigene89459_L / 10.92 / intracellular membrane-bounded organelle / nucleic acid binding / RNA processing / hypothetical protein
Unigene13942_L / 8.25 / - / - / cellular response to stress / predicted protein
Unigene64712_L / 8.16 / external encapsulating structure / nucleic acid binding / cellular response to starvation / S-like ribonuclease
Unigene81699_L / 7.98 / - / - / - / WRKY transcription factor
Unigene17315_L / 10.03 / plastid / nucleic acid binding / response to metal ion / MYB transcription factor
Unigene74958_L / 3.1 / plastid stroma / cation binding / response to radiation / unnamed protein product
Unigene754_L / 2.68 / plastid / - / response to stress / mitochondrial small heat shock protein
Unigene85002_L / 2.57 / intrinsic to membrane / - / response to osmotic stress / Vesicle-associated membrane protein
Unigene15834_L / 2.09 / endoplasmic reticulum part / protein binding / response to heat / heat shock protein binding protein
Unigene38988_L / -8.28 / - / - / - / verticillium wilt disease resistance protein precursor
Unigene10151_L / -7.81 / intracellular membrane-bounded organelle / metal ion binding / response to radiation / hypothetical protein RCOM
Signal transduction
Unigene84874_L / 3.1 / - / receptor signaling protein / protein modification process / unnamed protein product
Unigene19687_L / 2.91 / intracellular membrane-bounded organelle / molecular transducer activity / intracellular signal transduction / predicted protein
Unigene79706_L / -8.36 / intrinsic to membrane / signal transducer activity / enzyme linked receptor protein signaling pathway / predicted protein
Unigene79183_L / -2.54 / - / - / - / Rop guanine nucleotide exchange factor
Unigene81812_L / -2.09 / - / protein binding / - / calmodulin-binding protein
Unigene66341_L / -2.07 / - / - / - / calmodulin binding protein
DNA replication
Unigene89270_L / -8.02 / - / - / - / RNA-directed DNA polymerase
Unigene25376_L / -3.37 / intracellular membrane-bounded organelle / nucleic acid binding / DNA metabolic process / MCM protein-like protein
Unigene91161_L / -2.94 / - / - / - / Putative kinesin-like protein, identical
Unigene85412_L / -3.14 / - / disulfide oxidoreductase activity / cellular homeostasis / unnamed protein product
Unigene5160_L / -2.67 / microtubule cytoskeleton / motor activity / cellularization / kinesin-like protein NACK1
Unigene1361_L / -2.46 / microtubule cytoskeleton / adenyl ribonucleotide binding / microtubule-based process / 125 kDa kinesin-related protein
Unigene94501_L / -2.4 / - / nucleic acid binding / DNA metabolic process / hypothetical protein
Unigene17180_L / -3.27 / - / nucleic acid binding / DNA metabolic process / unnamed protein product
Unigene82081_L / -2.8 / protein complex / DNA-directed RNA polymerase activity / DNA metabolic process / unkown protein
Unigene94501_L / -2.4 / - / nucleic acid binding / DNA metabolic process / hypothetical protein
Unigene2835_L / -2.19 / intracellular membrane-bounded organelle / nucleic acid binding / DNA metabolic process / hypothetical protein isoform 1
RNA synthesis
Unigene89562_L / -9.02 / intracellular membrane-bounded organelle / DNA binding / regulation of gene expression / class I KNOX homeobox transcription factor
Unigene9165_L / -3.1 / cell part / phosphonate transmembrane transporter activity / - / white-brown-complex ABC transporter family
Unigene90301_L / -2.74 / - / RNA binding / response to osmotic stress / poly(A)-binding protein
Unigene94405_L / -1.52 / - / RNA polymerase activity / positive regulation of cellular process / RNA-directed RNA polymerase
Unigene90807_L / -2.27 / - / - / - / nuclear protein skip
Unigene22425_L / -2.07 / ribonucleoprotein complex / RNA binding / gene expression / ribosomal protein L20
Unigene89931_L / -3.55 / large ribosomal subunit / structural molecule activity / gene expression / 60S ribosomal protein L7-like protein
Unigene87305_L / -3.36 / ribonucleoprotein complex / structural molecule activity / gene expression / similar to 50S ribosomal protein-related
Nucleotide synthesis
Unigene82298_L / -8.11 / cell part / - / purine transport / purine permease
Unigene91544_L / -3.17 / plastid / nucleotidase activity / - / cytosolic purine 5-nucleotidase
Unigene85442_L / -2.14 / intracellular part / nucleobase / nucleotide metabolic process / unknown protein
Unigene1643_L / -9.67 / plastid stroma / metal ion binding / response to metal ion / adenylosuccinate synthase
Unigene82081_L / -2.8 / protein complex / DNA-directed RNA polymerase activity / DNA metabolic process / unknown protein
Unigene67954_L / -2.47 / cytoplasmic part / transferase activity / purine base salvage / hypothetical protein
Unigene18686_L / -2.42 / external encapsulating structure / cation binding / purine base metabolic process / unknown protein
Unigene85442_L / -2.14 / intracellular part / nucleobase / nucleotide metabolic process / unknown protein
Unigene51639_L / -2.08 / - / adenyl nucleotide binding / metabolic process / aldehyde oxidase
Amino acid synthesis
Unigene77537_L / -2.62 / - / - / - / proline-rich protein
Unigene16635_L / -2.06 / intracellular part / transferase activity / toxin metabolic process / glutathione S-transferase
Unigene39914_L / -2.03 / - / carbon-nitrogen ligase activity / glutamine family amino acid metabolic process / asparagine synthetase
Unigene1643_L / -9.67 / plastid stroma / metal ion binding / response to metal ion / adenylosuccinate synthase
Unigene81513_L / -2.32 / - / aminoacyl-tRNA ligase activity / tRNA aminoacylation for protein translation / unnamed protein product
Protein synthesis
Unigene71940_L / -8.11 / intracellular part / translation factor activity / translation / eukaryotic initiation factor iso4E
Unigene60707_L / -3 / - / - / - / eukaryotic translation initiation factor 2c
Unigene8786_L / -5.12 / intracellular / - / - / structural constituent of ribosome
Unigene1752_L / -2.97 / cytoplasmic vesicle / endopeptidase activity / protein metabolic process / cysteine protease
Unigene48663_L / 4.11 / large ribosomal subunit / structural molecule activity / gene expression / hypothetical protein
Unigene83901_L / 4.1 / plastid stroma / structural molecule activity / reproductive developmental process / predicted protein
Unigene89931_L / -3.55 / large ribosomal subunit / structural molecule activity / gene expression / 60S ribosomal protein L7-like protein
Unigene87305_L / -3.36 / ribonucleoprotein complex / structural molecule activity / gene expression / similar to 50S ribosomal protein-related
Unigene22425_L / -2.07 / ribonucleoprotein complex / RNA binding / gene expression / ribosomal protein L20
Unigene16635_L / -2.06 / intracellular part / transferase activity / toxin metabolic process / glutathione S-transferase
Protein transport and modification
Unigene24926_L / -7.81 / intrinsic to membrane / signal transducer activity / protein modification process / predicted protein
Unigene84660_L / -3.98 / membrane / signal transducer activity / protein modification process / predicted protein
Unigene60697_L / -3.87 / cytoplasmic membrane-bounded vesicle / binding / protein transport / hypothetical protein
Unigene72_L / -3.78 / - / protein kinase activity / protein modification process / Protein kinase PVPK-1
Unigene9267_L / -3.63 / intrinsic to membrane / signal transducer activity / protein modification process / gunnamed protein product
Unigene87658_L / -3.61 / intracellular membrane-bounded organelle / transcription regulator activity / protein modification process / SNI1
Unigene30179_L / -3.6 / intracellular membrane-bounded organelle / UDP-galactosyltransferase activity / protein modification process / Beta-1,3-galactosyltransferase sqv-2
Unigene24916_L / -2.29 / cell wall / receptor signaling protein serine/threonine kinase activity / protein modification process / predicted protein
Unigene81006_L / -2.47 / intrinsic to membrane / peptidase activity / protein metabolic process / hloroplast thylakoidal processing peptidase
Glycometabolism
Unigene67394_L / -12.03 / - / oxidoreductase activity / glucose glucose process / expressed protein
Unigene23564_L / -9.75 / - / cofactor binding / cellular polysaccharide biosynthetic process / RHM1
Unigene14408_L / -9.24 / external encapsulating structure / hydrolase activity / catabolic process / class IV chitinase
Unigene81600_L / -8.36 / plastid outer membrane / hexokinase activity / glucose catabolic process / predicted protein
Unigene88020_L / -3.72 / intracellular membrane-bounded organelle / racemase and epimerase activity / hexose metabolic process / UDP-D-xylose 4-epimerase
Repiration
Unigene69103_L / 3.41 / mitochondrial respiratory chain / heme-copper terminal oxidase activity / - / unknown protein
Unigene8620_L / -8.5 / mitochondrial inner membrane / NADH dehydrogenase (quinone) activity / metabolic process / external rotenone-insensitive NADPH dehydrogenase
Unigene77797_L / -2.36 / - / binding / fatty acid metabolic process / acyl carrier protein
Unigene81600_L / -8.36 / plastid outer membrane / hexokinase activity / glucose catabolic process / predicted protein
Photosynthesis
Unigene79622_L / -8.2 / plastid envelope / oxidoreductase activity / photosynthetic electron transport chain / Plastid lipid-associated protein 2
Unigene52323_L / -2.86 / - / protein kinase activity / protein modification process / PEPC kinase 1b
Unigene93656_L / -2.48 / intracellular membrane-bounded organelle / - / - / chloroplast lipocalin
Unigene81006_L / -2.47 / intrinsic to membrane / peptidase activity / protein metabolic process / chloroplast thylakoidal processing peptidase
Unigene87555_L / -2.15 / - / nucleic acid binding / porphyrin biosynthetic process / Mg-chelatase subunit XANTHA-F
Unigene25322_L / -2.01 / intracellular membrane-bounded organelle / catalytic activity / - / phytoene dehydrogenase
Plant hormone-realted
Unigene22730_L / -9.06 / - / - / cellular process / Auxin response factor
Unigene2665_L / -8.69 / - / - / response to hormone stimulus / Auxin-induced protein 6B
Unigene90302_L / 5.12 / - / oxidoreductase activity / response to other organism / 1-aminocyclopropane-1-carboxylate oxidase
Unigene85262_L / 6.39 / organelle membrane / receptor signaling protein serine/threonine kinase activity / ethylene mediated signaling pathway / CTR1-like protein kinase
Unigene40281_L / 5.09 / - / binding / ethylene biosynthetic process / unnamed protein product
Unigene80649_L / -2.02 / organelle membrane / signal transducer / two-component signal transduction system / ethylene receptor, putative
Unigene88324_L / -1.63 / - / - / - / ethylene-responsive element binding protein (EREBP)
Unigene92921_L / -1.41 / - / binding / - / ethylene-overproduction protein 1
Cell division
Unigene62235_L / -10.74 / cell part / - / cellular cell wall organization / expansin 2
Unigene89562_L / -9.02 / intracellular membrane-bounded organelle / DNA binding / regionalization / class I KNOX homeobox transcription factor
Unigene89562_L / -9.02 / intracellular membrane-bounded organelle / DNA binding / regionalization / class I KNOX homeobox transcription factor
Unigene91169_L / -8.28 / - / - / - / cyclin D2
Unigene42232_L / -4.08 / intracellular membrane-bounded organelle / - / mphase of mitotic cell cycle / G2/mitotic-specific cyclin-1
Unigene91498_L / -2.83 / protein complex / protein serine/threonine kinase activity / protein amino acid phosphorylation / B2-type cyclin dependent kinase
Nutrition-reltated
Unigene63734_L / -3.9 / intrinsic to membrane / farnesyltranstransferase activity / lipid metabolic process / squalene synthase
Protein degradation
Unigene58435_L / 3.28 / - / hydrolase activity / protein metabolic process / pyroglutamyl-peptidase I
Unigene49002_L / 2.23 / - / - / - / proteasome subunit beta type
Unigene73750_L / -5.01 / - / endopeptidase activity / protein metabolic process / predicted protein
Unigene24447_L / -9.87 / - / transition metal ion binding / - / predicted protein
Unigene80784_L / -2.62 / - / - / - / cyclin-specific ubiquitin carrier protein
Unigene94235_L / -3.57 / - / binding / - / hypothetical protein
Unigene92434_L / -2.9 / intracellular membrane-bounded organelle / transition metal ion binding / chromatin organization / unnamed protein product
Unigene87409_L / -2.53 / intracellular membrane-bounded organelle / protein-lysine N-methyltransferase activity / - / hypothetical protein
Fatty acid synthesis
Unigene22246_L / 5.38 / microbody / - / jasmonic acid metabolic process / acyl-COA ligase
Unigene91402_L / -8.28 / - / fatty acid synthase activity / fatty acid metabolic process / enoyl-ACP reductase 1-2
Unigene20622_L / -2.53 / - / fatty acid synthase activity / fatty acid metabolic process / enoyl ACP reductase
Unigene77797_L / -2.36 / - / binding / fatty acid metabolic process / acyl carrier protein
Physiologicalrhythm
Unigene85715_L / -9.11 / - / lyase activity / - / cryptochrome 1
Unigene17315_L / 10.03 / plastid / nucleic acid binding / response to metal ion / MYB transcription factor
Unigene341_L / 3.08 / intracellular membrane-bounded organelle / - / regulation of gene expression / predicted protein
Unigene85715_L / -9.11 / - / lyase activity / - / cryptochrome 1
Unigene20558_L / 7.98 / cell part / transition metal ion binding / regulation of gene expression / hypothetical protein