Supplementary Information for “Engineered Biosynthesis of the Antiparasitic Agent Frenolicin B and Rationally Designed Analogs in a Heterologous Host”
Cloning
Standard microbiological techniques were used to construct expression vectors. Generally, this involved PCR of a gene from genomic DNA or a previous construct, ligation into pCR Blunt, excision with XbaI/SpeI and insertion into a pUC18 derived vector. These pUC18 derived vectors were used to build up a XbaI/EcoRI fragment which was then transferred to the shuttle vector, pRM5 for transformation into S. coelicolor CH999/pBOOST*. The primers used to amplify each gene in a given expression plasmid are listed in Table S1 unless already described in the literature. Table S2 gives notes on the construction of each new vector using previously published vectors as starting points.
Production, Isolation, and Characterization of Polyketide Products
For preparative scale studies 3-4 L of each strain was grown on R5 agar plates (Kieser et al., 2000) containing 50 mg/l thiostrepton and 100 mg/l of apramycin at 30°C for 7 days. The agar was mashed and extracted with either 100% EtOAc or EtOAc/MeOH/Acetic Acid (89:10:1).
The extract was dried with toluene, and the solvent was removed in vacuo. The crude extract was passed through a silica gel column using either 100% EtOAc or 1% acetic acid in ethyl acetate. The eluate was dried, and redissolved in 3-4 ml methanol before injection onto a preparative reverse-phase HPLC column (250 mm x 22 mm, C18 column, Vydac). For some strains the eluate was extracted with a saturated solution of sodium bicarbonate to pull out derivatives of compounds2, and 5 prior to injection on HPLC. Gradients used were generally a fast ~30 min rise to 35-50% MeCN in water (0.1% TFA) followed by a slow raise (80 min) to 50-60% MeCN in water (0.1% TFA) with a flow rate of 5 ml/min. Purified fractions were dried in vacuo or by lyophilization.
Biological Assays
The growth inhibition curves for T. gondii with antiparasitic compounds are shown in Figures S1 and S2. Cytotoxicity data is shown in Figure S3.
Compound Characterization
Mass spectrometry of compounds isolated in this study is shown in Table S3 and NMR characterizations are shown in Tables S4-S13. 1H NMRs are shown for selected compounds in Figures S4-S15.
Metabolic Profiles
The metabolic profile of each strain was characterized by analytical HPLC. In each case the strain was extracted with an equal volume of either ethyl acetate or 99% ethyl acetate and 1% acetic acid overnight, the crude extract concentrated in vacuo, centrifuged to remove cell debris, and run on a reverse phase Grace C18 column (250 x 4.6 mm). Traces were recorded at 280 nm (blue) and 410 nm (red) on a UV-Vis detector for each new strain (Figures S16-18). The presence of a peak at 410 nm usually indicates a metabolite which is a quinone or semiquinone derivative.
References
1.Bibb, M.J., Sherman, D.H., Omura, S. & Hopwood, D.A. Cloning, sequencing and deduced functions of a cluster of Streptomyces genes probably encoding biosynthesis of the polyketide antibiotic frenolicin. Gene142, 31-39(1994).
2.McDaniel, R., Ebert-Khosla, S., Hopwood, D.A. & Khosla, C. Engineered biosynthesis of novel polyketides: manipulation and analysis of an aromatic polyketide synthase with unproven catalytic specificities. J. Am. Chem. Soc.115, 11671–11675(1993).
3.Tang, Y., Lee, T.S. & Khosla, C. Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases. PLoS Biol.2, 227-238(2004).
4.Lee, T.S., Das, A. & Khosla, C. Structure-activity relationships of semisynthetic mumbaistatin analogs. Bioorg. Med. Chem.15, 5207-5218(2007).
5.McDaniel, R., Ebert-Khosla, S., Hopwood, D.A. & Khosla, C. Engineered biosynthesis of novel polyketides: actVII and actIV genes encode aromatase and cyclase enzymes, respectively. J. Am. Chem. Soc.116, 10855-10859(1994).
6.Zhang, H. et al. Mutactin, a novel polyketide from Streptomyces coelicolor. Structure and biosynthetic relationship to actinorhodin. J. Org. Chem.55, 1682–1684(1990).
7.Khosla, C. et al. Genetic construction and functional analysis of hybrid polyketide synthases containing heterologous acyl carrier proteins. J. Bacteriol.175, 2197-204(1993).
gene / primerfrnI-F / GCTCGACTGCAGTGACCGGCGAGGCGGAGATGCTC
frnI-R / GCCTGTTTAAACTCCGCGCGGCCGTCCGTGTCTCG
frnJ-F / GCTCTAGAGGAGGACCATCATGAGCFCCTTCACTCTCACCG
frnJ-R / GCCTGCAGTCAGGTGCGGGAACCCGCGCGCGC
frnN-F / GCTCTAGAGGAGGACCATCATGAGCGCACTGACCGTCGACG
frnN-R / GCACTAGTCAGGCGGTGGCCGGGGTGGTGTTG
frnK-F / GCTCTAGAGGAGGACCATCATGCGGAGCGAGGGCGGTACGGAGG
frnK-R / GCACTAGTCAGCCCCCGTCCCGTACGACCTG
actVI-ORF1-F / GGAATTTCTAGAGGAGGACCCATATGAGCACCGTGACAGTGATCGGGC
actVI-ORF1-R / GGAATTGAATTCCCCCCCCACTAGTTCAGTGGTGGTGGTGGTGGTGCTTGGTCTCCTCCTGGGGCTGCTCG
actVI-ORF2-F / GGTCTAGAGGAGGAGCCATCGTGATGCGTGCCGTGCAGTTCGAC
actVI-ORF2-R / GGACTAGTTCAGGGGACGAGCACGACCCGGCC
actVI-ORF4-F / GGTCTAGAGGAGGAGCCATCGGAGAACGCATGCCCAAGGCCGTA
actVI-ORF4-R / GGACTAGGTCACAGGTCCGGCACCAGGACGAG
Table S1. Primers used to amplify genes in this study. All frn genes were amplified from pIJ5214 1, and all act genes were amplified from S. coelicolor A(3)2 gDNA. Restriction sites as well as start and stop codons have been highlighted in bold.
expression plasmid / notespJF6 / actVI-ORF1 was inserted into the XbaI site of pRM5
pCR66 / actVI-ORF1 and actVI-ORF2 were inserted into the XbaI site of pRM5
pCR67 / actVI-ORF1, actVI-ORF2, and actVI-ORF4 were inserted into the XbaI site of pRM5
pJF35 / frnLM from pRM34a was inserted into TSL9 in place of the tcm KS/CLF PacI/ XbaI fragment
pTSL9 / frnKNJI was inserted into pYT127b in place of zhuCNGH
pJF9 / actVI-ORF1 and actVI-ORF2 were inserted into the XbaI site of pYT127
Table S2. Notes on Shuttle Vector Construction For metabolite analysis, each plasmid was introduced into S. coelicolor CH999/pBOOST* via transformation. a) McDaniel et al.2 b) Tang et al.3.
Figure S1. Growth Inhibition of T. gondii with Antiparasitic Agents. Error bars are calculated from the SEM, and when not visible are smaller than the symbol.
Figure S2. Growth Inhibition of T. gondii with compound 1c. Error bars are calculated from the SEM, and when not visible are smaller than the symbol.
Figure S3. Cytotoxicity of Antiparasitic Agents Used in this Study. Error bars are calculated from the SEM, and when not visible are smaller than the symbol.
New Compounds / Calculated Mass / ES+ / ES- / Exact Mass ES+1c / 342.1103 / 343.35 / 341.29 / 343.1189
1d / 356.1360 / 357.36 / 355.43 / 357.1348
2c / 344.13 / 345.34 / 343.35
2d / 358.14 / 359.36 / 357.43
5c / 328.13 / 329.2 / m-CO2=283.3
5d / 342.15 / 343.1 / 341.2
6b / 326.08 / N/A / 325.1
8 / 312.10 / 313.2 / 311.4
9 / 330.11 / 331.3 / 329.4
Table S3. Calculated masses and experimentally determined masses for novel compounds in this study. Exact mass was determined for the biologically tested novel analogs 1c and 1d.
1a / Frenolicin B (1b)no. / 13C / 1H / 13C / 1H / Long-range 13C-1H HMBC correlations / Long-range 1H -1H COSY correlations
1 / 173.9 / 176.2
2 / 36.9 / 2.97(dd, J=17.7, 5.2, 1H)
2.71(d, J= 17.7, 1H) / 36.5 / 3.14 (dd,J= 17.8, 5.2 Hz, 1H), 2.55 (d,J= 17.7 Hz, 1H) / a)1,3 b)1 / 2,3
3 / 66.4 / 4.69(dd, J=5.2, 3.0, 1H) / 66.7 / 4.70 (dd,J= 5.1, 3.0 Hz, 1H) / 1,15 / 2,4
4 / 68.6 / 5.26(d, J=3.0, 1H) / 69.8 / 5.32 (d,J= 3.0 Hz, 1H) / 3,5,6,14 / 3
5 / 135.1 / 135.4
6 / 181.5 / 181.8
7 / 131.5 / 131.9
8 / 119.8 / 7.71(dd, J=7.6, 1.5, 1H) / 119.0 / 7.67 (dd,J= 7.5, 1.2 Hz, 1H) / 6,10,12 / 9
9 / 137.2 / 7.67(dd, J=8.3, 7.6, 1H) / 137.0 / 7.74 (dd,J= 8.4, 7.5 Hz, 1H) / 6,7,11,12 / 8,10
10 / 124.9 / 7.31(dd, J=8.3, 1.5, 1H) / 124.3 / 7.32 (dd,J= 8.4, 1.2 Hz, 1H) / 8,11,12 / 9
11 / 161.9 / 161.6
12 / 114.8 / 115.1
13 / 188 / 188.4
14 / 149.7 / 149.3
15 / 66.2 / 4.91(t, 1H) / 69.9 / 4.91(t, 1H) / 3,5,14 / 16,18
16 / 18.6 / 1.57(d, J=6.8, 3H) / 19.4 / 1.83(m, 2H) / 17 / 15,17,18
17 / 33.1 / 1.58(m, 2H) / 16,18
18 / 12.7 / 1.04 (t,J= 7.4 Hz, 3H) / 17 / 16,17
Table S4. 1H and 13C NMR data for 1awas recorded in CDCl3and 1b was recorded in CD3OD (500 MHz for 1H and 125 MHz for 13C). Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
1cno. / 13C / 1H / Long-range 1H -1H COSY correlations
1
2 / 37.3 / 3.14 (dd,J= 17.7, 5.2 Hz, 1H),
2.56 (d,J= 17.7 Hz, 1H) / 3
3 / 67.8 / 4.70 (dd,J= 5.1, 3.0 Hz, 1H) / 2,4
4 / 71.1 / 5.32 (d,J= 2.9 Hz, 1H) / 3
5
6
7
8 / 120.6 / 7.68 (dd,J= 7.5, 1.0 Hz, 1H) / 9
9 / 138.7 / 7.74 (dd,J= 8.4, 7.5 Hz, 1H) / 8,10
10 / 125.9 / 7.32 (dd,J= 8.4, 1.0 Hz, 1H) / 9
11
12
13
14
15 / 71.3 / 4.89(t, 1H) / 16
16 / 31.3 / 1.83(m, 2H) / 15
17 / 22.4 / 1.46(m, 2H)
18 / 30.3 / 1.61(m, 2H)
19 / 13.7 / 0.99 (t,J= 7.3 Hz, 3H)
Table S5. 1H and 13C NMR data for1c were recorded in CD3OD (600 MHz for 1H and 125 MHz for 13C). Carbon atoms were assigned through HSQC experiments. Where assignments could not be conclusively made the position was left blank. Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
1dno. / 13C / 1H / Long-range 13C-1H HMBC correlations / Long-range 1H -1H COSY correlations
1 / 176.2
2 / 37.3 / 3.15 (dd,J= 17.8, 5.2 Hz, 1H), 2.56 (d,J= 17.8 Hz, 1H) / a)1,3 b)1 / 3
3 / 67.6 / 4.69 (dd,J= 5.0, 3.0 Hz, 1H) / 2,4
4 / 70.8 / 5.33 (d,J= 2.9 Hz, 1H) / 5 / 3
5 / 135.3
6 / 181.7
7 / 131.8
8 / 120.0 / 7.68 (d,J= 7.4 Hz, 1H) / 10,12 / 9,10
9 / 138.2 / 7.74 (t,J= 7.9 Hz, 1H) / 6,7,11 / 8,10
10 / 125.4 / 7.33 (d,J= 8.4 Hz, 1H) / 8,12 / 9,10
11 / 161.7
12 / 114.9
13
14 / 149.0
15 / 71.3 / 4.84(t, 1H) / 3,5,14,16,17 / 16
16 / 29.9 / 1.83(m, 2H) / 15
17 / 36.2 / 1.48(m, 2H) / 15,18
18 / 28.6 / 1.67(m, 2H) / 17
19 / 22.6 / 0.97(m, 3H) / 17,18,20
19' / 22.6 / 0.97(m, 3H) / 17,18,19
Table S6. 1H and 13C NMR data for1d was recorded in CD3OD (600 MHz). Carbon atoms were assigned through a combination of HSQC and HMBC (bold) experiments. Where assignments could not be conclusively made the position was left blank. Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
2a / 2bno. / 1H / 1H
1
2 / 2.71 (dd,J= 4.5, 15.6, 1H), 2.59 (dd,J= 8.4, 15.6, 1H) / 2.66 (dd,J= 15.4, 4.2 Hz, 1H),
2.53 (dd,J= 15.2, 8.3 Hz, 1H)
3 / 4.41 – 4.34 (m, 1H) / 4.31 (ddd,J= 12.4, 8.0, 3.7 Hz, 1H)
4 / 2.85 (dd,J= 2.7, 18.5, 1H), 2.33 (dd,J= 10.4, 19.1, 1H) / 2.81 (dd,J= 19.1, 3.5 Hz, 1H),
2.28 (ddd,J= 19.2, 10.5, 2.1 Hz, 1H)
5
6
7
8 / 7.63 (d,J= 6.4, 1H) / 7.59 (dd,J= 7.4, 1.1 Hz, 1H)
9 / 7.69 (t,J= 7.9, 1H) / 7.65 (dd,J= 8.1, 7.5 Hz, 1H)
10 / 7.29 (d,J= 7.3, 1H) / 7.25 (dd,J= 8.1, 0.8 Hz, 1H)
11
12
13
14
15 / 4.99 (d,J= 6.4, 1H) / 4.79 (d,J= 10.5 Hz, 1H)
16 / 1.60 (d,J= 6.8, 3H) / 1.8-1.9 (m, 2H)
17 / 1.5-1.7 (m, 2H)
18 / 1.00 (t,J= 7.4 Hz, 3H)
Table S7. 1H data for 2a-b was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
2c / 2dno. / 1H / 1H
1
2 / 2.68 (dd,J= 15.4, 3.9 Hz, 1H), 2.53 (dd,J= 15.2, 8.7 Hz, 1H) / 2.68 (dd,J= 15.3, 3.8 Hz, 1H),
2.53 (dd,J= 15.3, 8.9 Hz, 1H)
3 / 4.32 (m,1H) / 4.31 (s, 3H),
4 / 2.81 (dd,J= 19.1, 3.1 Hz, 1H), 2.29 (dd,J= 21.0, 8.8 Hz, 1H) / 2.84 – 2.78 (m, 1H),
2.28 (d,J= 18.7 Hz, 1H)
5
6
7
8 / 7.60 (d,J= 7.5 Hz, 7H) / 7.60 (d,J= 7.4 Hz, 1H)
9 / 7.66 (t,J= 7.9 Hz, 1H) / 7.66 (t,J= 7.9 Hz, 1H)
10 / 7.26 (d,J= 8.3 Hz, 1H) / 7.26 (d,J= 8.4 Hz, 1H)
11
12
13
14
15 / 4.74 (m, 1H), / 4.74 (s, 1H)
16 / 1.8-1.9 (m, 2H) / 1.8-1.9 (m, 2H)
17 / 1.5-1.7 (m, 2H) / 1.5-1.7 (m, 2H)
18 / 1.5-1.7 (m, 2H) / 1.5-1.7 (m, 1H)
19, 19' / 0.98 – 0.93 (t, 3H) / 0.96 (d,J= 6.9 Hz, 6H)
Table S8. 1H data for 2c-d was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
5ano. / 13C / 1H
1 / 176.7
2 / 33.3 / 2.95 (dd, J=16.4, 7.4, 1H),
2.79 (dd, J=16.4, 6.0, 1H)
3 / 39.9 / 4.75 (1H, m, 3H)
4 / 26.5 / 2.93 (ddd, J=16.4, 3.4, 1.0, 1H),
2.79 (ddd, J=16.0, 10.5, 1.7, 1H)
5 / 111.3
6 / 134.9 / 6.26 (s, 1H)
7 / 138.3
8 / 117 / 6.79 (dd, J=8.2, 0.9, 1H)
9 / 116.1 / 7.38 (dd, J=8.2, 7.6, 1H)
10 / 114.5 / 6.75 (dd, J=7.6, 0.9, 1H)
11 / 163.2
12 / 128.2
13 / 188.5
14 / 128.2
15 / 138.3
16 / 23.3 / 2.65 (s, 3H)
Table S9. 1H data for 5a was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
5c / 5dno. / 1H / 1H
1
2 / 2.95 (m, 1H),
2.77 (m, 1H) / 2.95 (dd,J= 16.8, 3.2 Hz, 1H), 2.78 (m, 1H)
3 / 4.74 (m, 1H) / 4.77 – 4.69 (m, 1H)
4 / 2.95 (m, 1H),
2.77 (m, 1H) / 2.92 (m, 1H),
2.78 (m, 1H)
5
6 / 6.35 (s, 1H) / 6.35 (s, 1H)
7
8 / 6.79 (d,J= 7.8 Hz, 1H) / 6.79 (d,J= 7.9 Hz, 1H)
9 / 7.40 (t,J= 7.9 Hz, 1H) / 7.40 (dd,J= 7.9 Hz, 1H)
10 / 6.69 (d,J= 8.0 Hz, 1H) / 6.69 (d,J= 8.1 Hz, 1H)
11
12
13
14
15
16 / 1.4-1.75(m, 2H) / 1.4-1.75(m, 2H)
17 / 1.4-1.75(m, 2H) / 1.4-1.75(m, 2H)
18 / 1.4-1.75(m, 2H) / 1.4-1.75(m, 1H)
19, 19' / 0.98 (t,J= 7.5 Hz, 3H). / 0.99 (dd,J= 6.6, 2.0 Hz, 6H)
Table S10. 1H data for 5c-d was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone.
6a / 6a / 6b / 6bno. / 13C / 1H / 13C / 1H
1 / 168.5 / 173.5
2 / 132.5 / 134.9
3 / 158.9 / 161.6
4 / 112.3 / 7.60 (s, 1H) / 113.8 / 7.60(2, 1H)
5 / 136.3 / 137.9
6 / 182.2 / 184.2
7 / 131.4 / 134.2
8 / 116.8 / 7.66 (dd, J=8, 1 Hz, 1H) / 119.3 / 7.69(dd, 7, 1, 1H)
9 / 136 / 7.72 (t, J=8 Hz, 1H) / 136.6 / 7.63(t, 7.5, 1H)
10 / 124.4 / 7.33 (dd, J=8, 1 Hz, 1H) / 125.4 / 7.27(dd, 8.5, 1.5, 1H)
11 / 161.4 / 163.5
12 / 122.5 / 123.8
13 / 189.4 / 191.2
14 / 118.3 / 118.6
15 / 140.8 / 148.5
16 / 19.9 / 2.66 (s, 3H) / 35.6 / 3.34-3.37(m, 2H)
17 / 25.4 / 1.68-1.73(m, 2H)
18 / 15.2 / 1.09(t, J=7.5, 3H)
Table S11. 1H data for 6a-b was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone. Original characterization from Lee et. al. 4
6c / 6c / 6dno. / 13C / 1H / 1H
1 / 174.4
2 / 134.3
3 / 160.1
4 / 114 / 7.46 (s, 1H) / 7.45 (s, 1H)
5 / 137.5
6 / 184.4
7 / 132.3
8 / 119.2 / 7.59(dd, J=8.0, 1.2, 1H) / 7.60 (dd, J=8.0, 1.2, 1H)
9 / 136.4 / 7.52 (t, 8.0, 1H) / 7.53 (t, J=8.0, 1H)
10 / 125.3 / 7.16 (dd, J=8.0, 1.2, 1H) / 7.17 (dd, J=8.0, 1.2, 1H)
11 / 163.5
12 / 124.4
13 / 191.2
14 / 118.2
15 / 140.3
16 / 40.9 / 3.31–3.39 (m, 2H) / 3.34–3.42 (m, 2H)
17 / 30.4 / 1.50–1.6 (m, 2H) / 1.42–1.52 (m, 2H)
18 / 31.7 / 1.40–1.48 (m, 2H) / 1.64–1.73 (m, 1H)
19, 19' / 23 / 0.90 (t, J=7.2, 3H) / 0.93 (d, J=6.4, 6H)
Table S12. 1H data for 6c-d was recorded in CD3OD (600 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone. Literature characterization: Tang et al. 3
8 / 9no. / 1H / 1H
1
2 / 5.43 (d,J= 2.0 Hz, 1H) / not obs.
3
4 / 6.18 (d,J= 1.3 Hz, 1H) / 5.51 (d,J= 1.9 Hz, 1H)
5
6 / 4.24 (d,J= 1.8 Hz, 1H), 3.85 (s, 1H)
7
8 / 6.94 (d, J = 8.5 Hz, 1H) / 6.83 (d,J= 8.3 Hz, 1H)
9 / 7.29 (dd, J = 8.5, 7.4 Hz, 1H) / 7.47 (dd,J= 8.3, 7.5 Hz, 1H)
10 / 6.73 (d, J = 7.4 Hz, 1H) / 6.74 (d,J= 7.5 Hz, 1H)
11
12
13
14 / 6.68 (s, 1H) / 3.04 (d,J= 17.1 Hz, 1H),
2.78 (d,J= 17.3 Hz, 1H)
15
16 / 1.5-1.7 (m, 2H) / 1.4-1.6 (m, 2H)
17 / 1.5–1.7 (m, 2H) / 1.4–1.6 (m, 2H)
18 / 0.86 (t,J= 7.3 Hz, 3H) / 0.80 (t, J = 7.2 Hz, 3H)
Table S13. 1H data for 8 and 9 was recorded in DMSO-d6(500 MHz). Carbon atoms are numbered according to their order of introduction in the polyketide backbone. See references for literature characterization of methyl-primed compounds 5-7.
Figure S4. The1H spectrum for 1a was recorded in CDCl3 (500 MHz).
Figure S5. The1H spectrum for 1b was recorded in CD3OD (500 MHz).
Figure S6. The1H NMR spectrum for 1c was recorded in CD3OD (600 MHz).
Figure S7. The1H NMR spectrum for 1d was recorded in CD3OD (600 MHz).
Figure S8. The1H NMR spectrum for 2c was recorded in CD3OD (600 MHz).
Figure S9. The1H NMR spectrum for 2d was recorded in CD3OD (600 MHz).
Figure S10. The1H NMR spectrum for 5a was recorded in CD3OD (600 MHz).
Figure S11. The1H NMR spectrum for 5c was recorded in CD3OD (600 MHz).
Figure S12. The1H NMR spectrum for 5d was recorded in CD3OD (600 MHz).
Figure S13. The1H NMR spectrum for 6b was recorded in DMSO-d6 (500 MHz).
Figure S14. The1H NMR spectrum for 8 was recorded in DMSO-d6. (500 MHz).
Figure S15. The1H NMR spectrum for 9 was recorded in DMSO-d6. (500 MHz).
Figure S16. Representative metabolic profile of the strains S. coelicolor/ pCR66/ pBOOST*, S. coelicolor/ pCR67/ pBOOST*, and S. coelicolor /pJF6/ pBOOST*. All strains were extracted overnight with ethyl acetate alone. Traces were recorded at 280 nm (blue) and 410 nm (red). The metabolic profiles of S. coelicolor/ pCR66/ pBOOST*, S. coelicolor/ pCR67/ pBOOST* are almost identical, whereas the profile of S. coelicolor /pJF6/ pBOOST*, as expected, does not have a peak for compound 2a, which is logical as the strain lacks an enoyl reductase.
Figure S17. HPLC trace of the deoxyfrenolicin producing strain S. coelicolor /pJF35/ pBOOST*, partially purified 2b, and frenolicin standards. Both strains were extracted overnight with 99% ethyl acetate and 1% acetic acid. The first trace contains a mix of three frenolicin standards isolated from S. roseofulvus. The second trace is a combination of fractions containing 2b, taken from a preparative HPLC of the S. coelicolor /pJF35/ pBOOST* strain. Traces were recorded at 280 nm (blue) and 410 nm (red). As can be seen in the partially purified extract 2b is present in a very small amount and nearly coelutes with 6b.
Figure S18. HPLC trace of S. coelicolor /pJF7/ pBOOST*, S. coelicolor /pJF9/ pBOOST*, and a partially purified extract of S. coelicolor /pJF9/ pBOOST*. Both strains were extracted overnight with ethyl acetate to exclude much of the 6c, 6d, 7c, and 7d derived products for ease of purification. The trace pJF9 base refers to an extract of of S. coelicolor /pJF9/ pBOOST* which underwent partial purification by a silica gel column eluted with 30% ethyl acetate in hexanes, followed by an extraction with saturated sodium bicarbonate, reacidification of the basic extract with 3M HCl, and finally extraction of the organic compounds with ethyl acetate . Traces were recorded at 280 nm (blue) and 410 nm (red).