Supplementary Materials and Methods

Generation of AES

Generation of pYUB1471 fragments ([(sacB-hyg)]cassette and oriE-cos fragment)

  1. Digest pYUB1471 with Van91I(~2hrs)
  2. Run on gel, there should be four bands (~sizes: 3672, 1614, 979, 574)
  3. Cut out the 3.7kb and 1.6kb bands into same tube and add QG buffer (Qiagen) ~ 1ml/µg of DNA
  4. Melt the 3.7kb and 1.6kb bands into QG buffer [store at -20oC if not using immediately]
  5. Arms can be stored indefinitely at -20oC; can be prepared in bulk

Generation of gene specificLHS and RHS fragments

  1. Set up PCR reactions using
  2. Both LL & LR primers in one set
  3. Both RL & RR primers in another set
  4. Use intact genomic DNA as the template
  5. Run products LHS (from LL & LR primers) and RHS (from RL & RR primers) on a gel
  6. Cut out correct size bands into separate tubes of QG buffer
  7. Elute each into 50µL of EB buffer (Qiagen)
  8. Digest 16µl of LHS and RHS fragments with the respective enzyme used in primer design (~2hrs in 20uL)

Four Fragments Ligation to generate AES

1.Into each tube of digested LHS and RHS, add 300µL QG buffer containing the 3.7kb and 1.6kb fragments

2.Pass the QG buffer of both tubes (~650µL) through the same gel elution column(Qiagen)

3.Elute the fragments in 30µL of elution buffer

4.Set up a regular 20µL ligation (17µl of eluted fragments from previous buffer) at RT overnight or a quick ligation using 17µl of the elution product [20µl final volume] for 30min

5.Transform the ligation mix into E. coli chemical competent cells (described below)

Transformation Protocol for E. coli chemical competent cells

  1. Transform C2987H E. coli cells (or appropriate E. coli strain)
  2. Mix tube of cells with 10µL of ligated DNA
  3. Incubate them for 30min on ice
  4. Incubate for 45sec at 42oC
  5. Incubate for 5min on ice
  6. Add 250µL SOC media, shake for 60min at 37oC
  7. Plate on LB agar plates containing Hyg (150µg/ml) to obtain single colonies
  8. Incubate overnight at 37oC
  9. Pick ~6 CFUs, amplify in 6mL of terrific broth containing Hyg(150µg/ml)
  10. Perform plasmid extraction.

Confirmation of the AES plasmids

  1. Digest 500ng of AES DNA with Van91I
  2. Run on a 1% agarose gel
  3. If Van91I is used in the LL, LR, RL and RR primers then there should be 4 fragments. Two of them would be of size 3672, 1614bp corresponding to ([(sacB-hyg)]cassette and oriE-cos fragment respectively. Other two fragments should correspond to the size of LHS and RHS.
  4. If any other enzyme (DraIII, BstAPI and AlwNI) is used then the pattern would depend on the position of Van91I in the LHS or RHS, whichever is the case). Make a plasmid map to make sure that you have the correct restriction pattern.
  5. Sequence AES plasmid for LHS and RHS sequence to confirm for the absence of any mutation during PCR.
  6. Mix 3-4uL of plasmid with .8uL of 100mM HygR out primer in tube 1
  7. AACTGCTCGCCTTCACCTTC
  8. Mix 3-4uL of plasmid with .8uL of 100mM SacB out primer in tube 2
  9. CGGCAGGTATATGTGATGGG
  10. Send for sequencing. When sequencing data returned, check that alignment with adjacent areas to target gene

Generation of specialized transducing phage [STP] phasmid DNA with the desired AES

  1. Digest shuttle phasmid phAE159 and the AES plasmid with PacI at 37oC for 2h
  2. Heat inactivate the PacI at 65oC for 15min
  3. If desired, run phAE159 digested with PacI on a gel, should see 2 bands (a high mol weight band of ~50kb and a low molecular weight band of ~3.8kb)
  4. Ligate phAE159 and AES in a 1:1 molar ratio of DNA at RT overnight
  5. λ package overnight ligation of AES and phAE159
  6. Thaw λ packing extract on ice (Max Plax, Cat # MP5110)
  7. On ice, add ~20µL of packaging mix per tube (green stock tube has ~50µL)
  8. Add 10µL of ligation mix
  9. Tap gently, incubate 120min at RT
  10. Add 500µl of MP buffer and mix by inverting
  11. Add 400µL of HB101 E. coli cells (See preparation of HB101 cells for λ packaging)
  12. Incubate 60min at 37oC
  13. Centrifuge at 10000g for 1min at RT
  14. Resuspend the pellet in 400µL of SOC media
  15. Plate 10µL, 50µL, 200µLon LB agar plates containing Hyg (150µg/ml) to obtain individual colonies
  16. Incubate plates overnight at 37oC
  17. Pick ~5 CFUs, amplify in 6mL of terrific broth containing Hyg(150µg/ml)
  18. Perform phasmid extraction using minprep plasmid isolation kit (Qiagen)
  19. Digest phasmids with PacI at 37oC
  20. Run on gel
  21. Should see 2 fragments (this is regardless of insertion orientation)
  22. 46972bp for phAE159
  23. Smaller fragment equal to size of AES plasmid

Generation of specialized transducing phage [STP] from phasmid DNA

  1. Electroporate 5-10µl phasmid DNA into 400µl competent mc2155 cells (See Making electrocompetent M. smegmatis mc2155 for details)
  2. Add 1ml 7H9 (w/o Tween 80) and incubate at 37ºC for 1hr.
  3. Add 300-600µl of transformation mix into 4ml top agar in snap cap tube, vortex to mix, and pour onto pre-warmed 7H10 plates (w/o Tween 80).
  4. Incubate the plates at 30ºC for 3 days

Amplification of STP’s in 30mm petri-dishes (effective if generating <10 STPs)

  1. Cut the tip off a p1000 pipette tip using a new razor blade (cut it off using the lid of an empty plate as the cutting board) so the circumference of the pipette tip opening is just slightly larger than the plaque you want to pick
  2. Center the plaque in the hole of the pipette tip and push down until tip hits the base of the plate
  3. Twist tip 90o, tilt slightly, and then remove from plate (a plug of agar including the plaque should be in the pipette tip)
  4. Plate the pipette tip into 200µL of MP buffer (may need to attach the pipette to the tip to push out the plug
  5. Let sit 1.5 hrs at RT
  6. Plate 2µL of neat and a 1:5 dilution with 300µL of SMEG to get lacy plates
  7. Set up 2 plates for each dilution
  8. Incubate the plates at 30ºC for 2 days.
  9. Add 4mL of MP buffer to the lacy plates and let shake for 20-30 min at RT
  10. Using a cell scraper, remove all the liquid and top agar from plates into a 50mL conical tube (all plates from same phage can be scraped into same tube)
  11. Spin at 4000rpm for 25 min
  12. Collect the supernatant into new 50mL conical tube
  13. Spin down at 4000rpm for 15 min
  14. Filter through a 0.45um filter
  15. Repeat until desired volume achieved

Amplification of STP’s in 24 well plate (effective if generating >10 STPs)

  1. Core out 1-2 plaques for each gene into 200µl MP buffer to recover phage; incubate at RT for 1.5hr then store at 4oC.
  2. Pour 1ml agar in each well of a 24-well plate (Costar 3524, Corning Inc.)
  3. In a separate 96 well plate aliquot 50µl of M. smegmatis mc2155 (Nunc 267334)
  4. Dilute 200µl of cored out STP plaques (from above) to approximate 104pfu/ml
  5. Aliquot 50µl of diluted STP phage to the respective 96 well plate.
  6. Incubate at RT for 15 min
  7. Add 200µl of top agar to each well.
  8. Gently mix up and down once
  9. Transfer the top agar/ mc2155/knockout phage mixture (280l) to the appropriate well of the 24-well plate
  10. Incubate the 24-well plate at 30oC
  11. Harvest the lysate and determine the titer

Specialized transduction to generate deletion-substitution mutants

  1. Grow culture of targeted M. tuberculosis to OD600 0.6-0.8
  2. A 10 ml culture is required for each transduction
  3. Transfer 10 ml culture to a 15 ml conical tube
  4. Spin in a tabletop centrifuge: 4000 rpm, 10 min, RT
  5. While cells are spinning, set up tubes for specialized transduction:

a)Set up one 15 ml conical tube per transduction. Label appropriately

b)Add 0.5-1 ml high-titer phage lysate to tube (1010-0.5ml, 109-1ml)

c)Incubate at room temperature (37C if you prefer, but this is not necessary) until you are ready to add the cells

  1. Decant supernatant
  2. Resuspend pellet in 10 ml MP buffer
  3. Spin in a tabletop centrifuge: 4000 rpm, 10 min, RT
  4. Optional: repeat steps 5-7 once
  5. Decant supernatant (at this point, use a P1000 to remove all traces of MP wash buffer)
  6. Resuspend pellet in 500µl MP buffer
  7. Transfer 250µl of cell suspension to appropriate tube containing phage lysate. Pipette up and down gently 2X to mix. Transfer 250µl of cell suspension into control tube (.5-1mL of MP as phage substitute)
  8. Incubate transduction reaction(s) at 37C, overnight
  9. After incubation, spin: 4000 rpm, 10 min, RT
  10. Decant supernatant (at this point, use a P1000 to remove all traces of MP wash buffer).
  11. Resuspend pellet in 200 µl 7H9 (with Tween-80)
  12. Spread resuspension (50µl and rest) over two 10 cm 7H9/OADC/glycerol/Agar plates containing Hyg(75µg/ml, supplement with the required amino acids if using auxotrophs)
  13. Incubate 37C, 3-4 weeks

Excision of sacB-hyg cassette from deletion substitution locus

  1. Grow up 10mL of mutant strain to OD 0.6-1.5
  2. Subculture into 10mL media to OD 0.6-0.8
  3. Transfer 3mL to 15mL falcon tube
  4. Spin down at 4000rpm for 10min
  5. Wash 2x with 10mL MP buffer
  6. Resuspend in 100-200µL of MP buffer (~ OD600 1.0-1.5)
  7. In a fresh 15mL snap-cap tube, add 500µL of phAE280 (unmarking phage) with a titer ~1010
  8. Add 30-50µL of washed cells
  9. Incubate tube at 37oC for 3 days
  10. Plate 100µL on 10% sucrose plate (plate with all normal media and additional sucrose)
  11. Add 1.5mL 7H9 with tween and all supplements to each tube
  12. For remaining volume, spread on same sucrose plates as follows (goal is to get isolated CFU’s)
  13. 20µL
  14. 100µL
  15. 300µL
  16. Remaining volume
  17. Incubate at 37oC for 3-4 weeks
  18. Do a colony PCR at this stage or
  19. Pick and patch 10-20 CFU’s per unmarked bacteria onto mirror plates (colonies can be confirmed by colony PCR at this stage 8-10 colonies are sufficient to screen)
  20. Normal media
  21. Normal media containing Hyg (75µg/ml)
  22. Incubate at 37oC for 2-3 weeks
  23. Unmarked bacteria are the ones that grow on the normal media, but not on the plates containing Hyg (75µg/ml) plates

Making electrocompetent M. smegmatis mc2155

  1. Grow 50ml of fresh M. smegmatis mc2155 culture. Desired OD600 is 0.8-1.0.
  2. If started from a frozen stock of mc2155, subculture at least twice into 10ml of media and used that as starter culture for the 50ml culture
  3. Put 50 ml conical tubes on ice for at least 10 minutes before using.
  4. Aliquot 25 ml mc2155 culture into each of two chilled 50 ml conical tubes.
  5. Spin tubes in tabletop centrifuge: 4000 rpm, 10 min, 4C.
  6. Decant supernatant.
  7. Re-suspend each pellet in 25 ml (1 volume) cold 10% glycerol.
  8. Spin tubes in tabletop centrifuge: 4000 rpm, 10 min, 4C.
  9. Repeat steps 5-7 once.
  10. Decant supernatant.
  11. Resuspend each pellet in 2.5 ml (0.1 volume) cold 10% glycerol.
  12. Cells are now ready for electroporation.
  13. If you are not using the cells immediately, they can be flash frozen and then stored at -80C until use.

Mycobacteriophage buffer (MP buffer – 1 L)

Stock solution / Final concentration (mM) / Volume (ml)
1 M Tris-HCl pH 8.0 / 50 / 50
5 M NaCl / 150 / 30
1 M MgCl2 / 10 / 10
1 M CaCl2 / 2 / 2
ddH2O / 908

Sterilize by autoclaving

Store at room temperature

Preparation of E. coli HB101 for transduction

  1. Grow E. coli HB101 overnight, 37°C in LB supplemented with 10 mM MgSO4, 0.2% maltose.
  2. Inoculate 25 ml of fresh medium with 0.5 ml of overnight culture.
  3. Shake culture at 200 rpm, 37°C until OD600 reaches 0.8-1.0.
  4. Harvest cells by centrifugation at 3000 rpm, 4°C, 10 minutes.
  5. Resuspend cells in 12.5 ml 10 mM MgSO4, 4°C.
  6. Store cells at 4°C until ready to use (good for ~2 weeks).

References

1.Balasubramanian, V., Pavelka, M.S., Jr., Bardarov, S.S., Martin, J., Weisbrod, T.R., McAdam, R.A., Bloom, B.R. and Jacobs, W.R., Jr. (1996) Allelic exchange in Mycobacterium tuberculosis with long linear recombination substrates. J. Bacteriol., 178, 273-279.

2.Jacobs, W.R., Jr., Barletta, R.G., Udani, R., Chan, J., Kalkut, G., Sosne, G., Kieser, T., Sarkis, G.J., Hatfull, G.F. and Bloom, B.R. (1993) Rapid assessment of drug susceptibilities of Mycobacterium tuberculosis by means of luciferase reporter phages. Science, 260, 819-822.

3.Carriere, C., Riska, P.F., Zimhony, O., Kriakov, J., Bardarov, S., Burns, J., Chan, J. and Jacobs, W.R., Jr. (1997) Conditionally replicating luciferase reporter phages: improved sensitivity for rapid detection and assessment of drug susceptibility of Mycobacterium tuberculosis. J. Clin. Microbiol., 35, 3232-3239.

1