DNA and RNA Isolation from White Blood Cells

Supplementary Methods

DNA and RNA Isolation from white blood cells

The DNA and RNA samples used in the genome-wide allelic expression study were isolated from buffy-coats (white blood cell-enriched blood samples, 35-37 ml) obtained from twelve anonymous individuals who were randomly selected at the Stanford Blood Center (Palo Alto, CA). These paired DNA and RNA samples were numbered 1 to 12. White blood cells were isolated from the buffy-coat samples by centrifugation in Ficoll density medium (Amersham Pharmacia). The white blood cells were then re-suspended in Trizol Reagent (Invitrogen) and RNA and DNA were purified according to the manufacture’s instruction. Each sample yielded between 200 g - 400 g of RNA and ~1 mg of DNA. The quality of the RNA was tested by visual inspection of intact RNA by gel electrophoresis. The RNA was then treated with DNase I, and purified again by phenol-chloroform extraction and ethanol precipitation. To test for the absence of DNA, the treated RNA was used as template for PCR reactions using 96 primer pairs: in contrast to genomic DNA templates, no amplification was seen from the RNA samples. cDNA was generated by reverse transcription of the RNA using SuperscriptII RT (Invitrogen) in the presence of random hexamers, followed by RNaseH treatment to eliminate the RNA. Both DNA and cDNA were diluted to 20 ng/l for use as templates in PCR reactions.

Short-Range PCR, Pooling and Purification of Samples

PCR reactions were performed in 384-well-plate format in a 12 l volume. The reaction concentrations were 1X PCR buffer, 2.75 mM MgCl2, 200 M dNTP, 0.4 M each primer, 0.3 units of AmpliTaq Gold DNA polymerase (Applied Biosystems), and 5 ng of either DNA or cDNA template. Touch down PCR was run at 95oC for 5 min; then 10 cycles of 30 sec at 95oC, 30 sec at 60oC with a reduction of 0.5oC for each cycle and 10 sec at 72oC; and finally 40 cycles of 10 sec at 95oC, 30 sec at 55oC and 30 sec at 72oC. The quality of the PCR products, which ranged in size from 60 to 200 bp, was tested by gel electrophoresis. PCR products from the same individual that were to be hybridized to the same array design were pooled together. 10ml of each pool of PCR products was concentrated, purified using Centricon Y-20 Columns (Millipore), and then quantified by OD260 readings. Samples were amplified in duplicate and the duplicates were pooled individually.

Labeling and Hybridization to Exonic SNP Arrays

5 g of each pool of purified PCR products was labeled with Biotin-ddUTP/biotin-dUTP in total volume of 37 l with a final concentration of 1X One-Phor-All buffer, 13.5 M Biotin-ddUTP/Biotin-dUTP and 0.5 units of Terminal Transferase (Roche). The labeling reactions were mixed with hybridization buffer (3 M tetramethylammonium chloride, 10 mM Tris-HCl, 0.01% Triton X-100, 100 g/ml Herring-Sperm DNA, 50 pM control oligonucleotide b948), denatured at 95oC for 10 min, and then incubated with the corresponding arrays for 16-18 hours at 50oC. The arrays were washed with 6X SSPE (0.9 M NaCl, 60 mM NaH2PO4, 6 mM EDTA, 0.01% Triton X-100) and stained firstly with 2.5 g/ml Streptavidin for 15 min, then with 1.25 g/ml anti-Streptavidin antibodies for 15 min, and finally with Streptavidin-Cychrome for 15 min. Between each staining, the arrays were washed with 6X SSPE using an automated fluidics wash station. Finally, the arrays were incubated with 0.2X SSPE for 30 min and filled with 6X SSPE for scanning. The hybridization of labeled sample was detected by measuring Cychrome fluorescence using a custom built confocal laser scanner (Perlegen Sciences). Because each sample was amplified and pooled in duplicate, two independent hybridizations were made for each sample.

Real-Time PCR

To validate the oligonucleotide array results, we used real-time PCR to independently measure differential expression of 12 exonic SNP alleles. We determined the ratio of reference allele to alternate allele for these 12 exonic SNPs in each of the individuals heterozygous for the particular SNP, using the methods described by Germer, et al. (2000). Real-time PCR was performed in quadruplicate on 384-well plates using 200 ng cDNA templates in 12 µl total reaction volumes. The same cDNA preparations were used for both the array and RT-PCR analyses.

Experimental examination of imprinted genes

Lymphoblast cell lines from the parents and heterozygous children of two CEPH families (Pedigree 1344 with nine children and Pedigree 1362 with 11 children) were purchased from the Coriell Institute for Medical Research and cultured at 37oC in RPMI medium supplemented with 15% FBS in a 5% CO2 incubator. The cells were spun down and suspended in Trizol Reagent (Invitrogen) and total RNA purified according to manufacture’s instruction. cDNA was generated as described above for the blood samples. We used real-time PCR with the following allele-specific primers to genotype the DNA samples and determine the allelic-expression of the cDNA samples: PRIM2A forward 1: TGGCCAAGATTACAGTACCCT; PRIM2A forward 2: TGGCCAAGATTACAGTACCCA; PRIM2A reverse: TGGTAGAAAGCAAATCAATCTGATC; FLJ33071 forward 1: AAGTAGGGATGCAAAATCCG; FLJ33071 forward 2: AGTAGGGATGCAAAATCCA; FLJ33071 reverse: CAAATCCTGGGTTCATTCACTAG; ZNF463 forward 1: ATGATCATCAATTATGTCAAAAGA; ZNF463 forward 2: TGATCATCAATTATGTCAAAAGG; ZNF463 reverse: GTGTTCTAGGAGGGGTGCCTT.

Reference

Germer, S., M.J. Holland, and R. Higuchi. 2000. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Res 10: 258-266.