Discussion of Error Propagation

In the main body of the paper we state that we determined the ratio of dissolved [Fe]/[PO4] associated with Fe limitation of N2 fixation in field populations of Trichodesmium is 0.004 mol/mol and ranges from 0 to 0.011 mol/mol with calculated error. The error associated with this value propagates from the extrapolation of three different linear and non-linear regressions that were involved in generating the value. Two non-linear regressions, a 2nd order polynomial used to fit [Fe’] verses % maximal N2 fixation rates and an exponential decay model used to fit [Fe’] verses isiB expression, were used to calculate the expression level associated with a 50% reduction in N2 fixation rates in Tten clade cultures: log10 (isiB/rnpB) = -1.20 0.1(Chappell and Webb, 2010).The final regression was a linear regression between log10 (isiB/rnpB) verses log10 ([Fe]/[PO4]) using field data, which resulted in the equation log10 (isiB/rnpB) = (-0.60+/- 0.14) log10 ([Fe]/[PO4]) + (-2.7+/- 0.28). In order to determine the error of the critical [Fe]/[PO4] value associated with crossing the threshold value log10 (isiB/rnpB) = -1.20 0.1, we used the error propagation formulae for subtraction, division and antilog (Supplementary Table 4).

References

Chappell, P.D., and Webb, E.A. (2010) A Molecular Assessment of the Iron Stress Response in the Two Phylogenetic Clades of Trichodesmium. Environ Microbiol 12: 13-27.

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792-1797.

Supplementary Table 1. Sampling times for SJ0609
Station / Local Time (Military Format)
13 / 1400
15 / 1500
16 / 1800
17 / 0500
18 / 0100
20 / 0700
21 / 1100
23 / 2200
Supplementary Table 2. QPCR Primers
Primer Name / 5’ Primer / 3’ Primer / Target Size (BP)
isiB QPCR (Ten) / AAGTGACTGGGCTGGTTTC / CAATAGTAGTACCTCCTTTCTCAG / 167
isiB QPCR (Tery) / AAAGTGACTGGAGTGGTTTC / GTAGTACCTCCAAGCCCA / 163
rnpB QPCR (Ten) / GAATCTATGAACGCAACGGAAC / ACCAGCAGTGTCGTGAGG / 102
rnpB QPCR (Tery) / ACCAACCATTGTTCCTTCG / CAAGCCTGCTGGATAACG / 199
Supplementary Table 3: Fe and PO4 with additional stations in the Pacific Ocean.
Station / Latitude / Longitude / PO4 (M) / StDev (M) / Fe (nM) / StDev (nM) / Fe/P / StDev
OC4 / 25.40 / -61.15 / 0.004 / 0.005 / 1.17 / 0.04 / 0.318 / 0.421
OC6 / 22.80 / -58.93 / 0.001 / 0.001 / 1.04 / 0.08 / 0.745 / 0.747
OC7 / 20.00 / -57.00 / 0.014 / 0.005 / 1.15 / 0.09 / 0.085 / 0.031
OC8 / 20.00 / -52.97 / 0.001 / 0.001 / 1.00 / 0.12 / 0.714 / 0.719
OC9 / 20.00 / -49.73 / 0.002 / 0.000 / 1.11 / 0.04 / 0.554 / 0.113
OC10 / 20.00 / -45.90 / 0.002 / 0.000 / 1.01 / 0.04 / 0.594 / 0.042
OC11 / 20.97 / -46.90 / 0.002 / 0.000 / 0.94 / 0.06 / 0.585 / 0.151
OC12 / 23.52 / -49.68 / 0.003 / 0.000 / 0.82 / 0.05 / 0.247 / 0.033
SJ13 / 12.40 / -27.20 / 0.045 / 0.000 / 0.74 / 0.12 / 0.016 / 0.003
SJ15 / 6.60 / -30.80 / 0.016 / 0.002 / 0.61 / 0.02 / 0.039 / 0.005
SJ16** / 3.30 / -32.90 / 0.037 / 0.002 / 0.09 / 0.00 / 0.002 / 0.000
SJ17** / 0.01 / -34.90 / 0.076 / 0.004 / 0.14 / 0.01 / 0.002 / 0.000
SJ18** / 1.80 / -38.50 / 0.031 / 0.009 / 0.10 / 0.00 / 0.003 / 0.001
SJ20 / 5.60 / -45.60 / 0.035 / 0.010 / 0.67 / 0.03 / 0.019 / 0.006
SJ21 / 7.50 / -49.20 / 0.068 / 0.009 / 1.89 / 0.03 / 0.028 / 0.004
WP7** / 7.88 / -172.34 / 0.111 / 0.000 / 0.16 / 0.02 / 0.001 / 0.000
WP8** / 5.65 / -174.53 / 0.147 / 0.002 / 0.41 / 0.03 / 0.003 / 0.000
WP9** / 3.24 / -176.88 / 0.167 / 0.002 / 0.21 / 0.02 / 0.001 / 0.000
WP10** / 0.37 / -179.64 / 0.324 / 0.000 / 0.11 / 0.04 / 0.0003 / 0.000
WP 11** / -2.30 / 177.44 / 0.189 / 0.002 / 0.11 / 0.04 / 0.001 / 0.000
WP 12** / -4.72 / 174.73 / 0.219 / 0.000 / 0.28 / 0.11 / 0.001 / 0.000
WP 13** / -7.07 / 172.31 / 0.167 / 0.000 / 0.31 / 0.11 / 0.002 / 0.001
WP14** / -9.25 / 170.00 / 0.168 / 0.000 / 0.20 / 0.04 / 0.001 / 0.000
WP15** / -12.58 / 169.86 / 0.133 / 0.002 / 0.11 / 0.03 / 0.001 / 0.000
WP16** / -15.89 / 169.72 / 0.169 / 0.000 / 0.29 / 0.03 / 0.002 / 0.000
WP16a** / -15.98 / 169.77 / 0.148 / 0.003 / 0.63 / 0.02 / 0.004 / 0.000
WP17* / -19.23 / 169.58 / 0.137 / 0.004 / 0.95 / 0.02 / 0.007 / 0.000
WP19* / -21.62 / 168.66 / 0.073 / 0.000 / 0.50 / 0.08 / 0.007 / 0.001
WP20** / -25.67 / 165.42 / 0.102 / 0.002 / 0.09 / 0.02 / 0.001 / 0.000
WP21* / -29.04 / 164.34 / 0.050 / 0.002 / 0.24 / 0.02 / 0.005 / 0.000
WP 22** / -31.92 / 163.36 / 0.072 / 0.000 / 0.21 / 0.08 / 0.003 / 0.001
WP23** / -34.16 / 162.55 / 0.066 / 0.000 / 0.29 / 0.02 / 0.004 / 0.000
WP24** / -36.17 / 161.79 / 0.076 / 0.002 / 0.19 / 0.02 / 0.002 / 0.000
WP25* / -34.23 / 160.35 / 0.065 / 0.000 / 0.36 / 0.03 / 0.006 / 0.000
WP26** / -32.42 / 159.09 / 0.084 / 0.002 / 0.20 / 0.02 / 0.002 / 0.000
WP 28* / -30.26 / 157.30 / 0.061 / 0.000 / 0.51 / 0.12 / 0.008 / 0.002
WP 29* / -29.76 / 156.62 / 0.068 / 0.002 / 0.41 / 0.00 / 0.006 / 0.000
WP 30** / -28.76 / 155.37 / 0.075 / 0.000 / 0.32 / 0.11 / 0.004 / 0.001
* indicates that Fe/P <= 0.008 ** indicates that Fe/P <= 0.004
Supplementary Table 4. Error Equations
Function / Error Equation
x = a - b / Ux = [Ua2 + Ub2](1/2)
x = a/b / Ux= x * [(Ua/a)2 + (Ub/b)2](1/2)
x = 10a / Ux = 2.303 * x * Ua

Figure Legends

Supplementary Figure 1. Alignment of isiB from T. tenue (strain H9-4) isiB, a clone from station 16a from cruise KM0701 showing where the HaeIII cut site is on the sequences that are part of the red outgroup, and a clone from station 14 from cruise KM0701 showing where the AclI cut site is on the sequences that are part of the blue outgroup.

Supplementary Figure 2. MUSCLE(Edgar, 2004) alignment of Tten isiB RT-PCR products from two stations from the Pacific Ocean and Trichodesmium isiB sequences in Genbank.

Supplementary Figure 3. Dissolved (< 0.4-μm-filtered) Fe (black bars) and PO4(grey bars) measured in surface seawater samples from the Atlantic Ocean (A) and Pacific Ocean (B). Station numbers correspond to stations locations listed in Table 1 and plotted in Figure 1. Error bars represent the standard error of duplicate (PO4) and triplicate (Fe) samples.