Supplementary methods

RT-PCR

Total RNA was extracted from cells homogenized in TRIzol® reagent (Gibco-BRL, Grand Island, NY, USA). The Omniscript Reverse Transcriptase Kit (Qiagen, Hilden, Germany) was used for reverse transcription of the RNA. Total RNA (2 µg) was addedto 20 µl ofthe following mixture: 2.0 µlof 10× RT buffer, 2.0 µlof dNTPs (5 mM each), 2.0 µl of oligo-(dT) primer (10 µM), 1.0 µlof RNase inhibitor (10 U/µl), 2 U of Omniscript reverse transcriptase, andRNAse-free water. Reverse transcription was carried out to synthesize cDNA. The synthesized cDNA was added to a mixture containing 1 U of Taq DNA polymerase (Roche Diagnostics, Indianapolis, IN, USA) and specific primers, and was amplified using an MJ Research Minicycler™ (Bio-Rad Laboratories, Hercules, CA, USA). PCR was performed under the following conditions: denaturation for 3 min at 96°C; 30 cycles of 30 s at 96°C, 30 s at 55°C, and 30 s at 72°C;and extension for 5 min at 72°C. PCR products were separated by electrophoresis on 1.5% agarose gels (Bio-Rad Laboratories) and were detected under ultraviolet light. The following primer pairs were used for vascular endothelial growth factor (VEGF)-A, VEGF-B, VEGF-C, and VEGF-D:

VEGF-A F,CGCGGATCCCTTTCTGCTGTCTTGGGTGC;

VEGF-A R, CGGAATTCCTGTAGGAAGCTCATCTCTC;

VEGF-B F, AGCACCAAGTCCGGATG;

VEGF-B R, GTCTGGCTTCACAGCACTG;

VEGF-C F, AGTTTTGCCAATTCACACTTCCTG;

VEGF-C R,GTCATTGGCAGAAAACCAGTCTT;

VEGF-D F,GTATGGACTCTCGCTCAGCAT;

AndVEGF-D R,AGGCTCTCTTCATTGCAACAG.

Western blotting

Cells were lysed with lysis buffer (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, protease inhibitor cocktail, phosphatase inhibitor cocktail) on ice for 30 min. The resulting lysates were centrifuged at 14,000 rpm at 4°C for 20 min and the protein concentrations of the clear lysates were determined using aCoomassie (Bradford) protein assay kit (Pierce, Rockford, IL, USA). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate the proteins, which were transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% non-fat dry milk in Tris-buffered saline (TBS)containing0.1% Tween 20 (TBST) at room temperature for 1 h, and then incubated overnight at 4°C with anti-c-Met,anti-phospho-Met, and anti-VEGF-Aprimary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The following day, the membrane was washed with TBST and incubated with the corresponding horseradish peroxidase-conjugated secondary antibody for 1 h. Finally, immunoreactive bands were visualized by enhanced chemiluminescence.

Plasmid transfection

A ligand-independent, constitutively active c-Met plasmid (TPR-Met) was purchased from Addgene (Cambridge, MA, USA) and transfected into TPC1 PTC cells using a microporator apparatus. Cells were also transfected with retrovirus with human c-Met-shRNA, which was cloned into pSuperRetro-Puro, according to the instructions of the manufacturer (Oligoengine). The target sequences was human c-Met-shRNA: acgtgaagatcccattgtctat.Cells were selected using puromycin for 2 weeks. Expression of TPR-Met was confirmed by Western blot analysis of phospho-c-Met.

Wound healing assay

Cells were plated in culture plates at a density of approximately 1×105/well and grown to confluency. The cells were then deprived of fetal bovine serum (FBS) for 48 h. Next, the monolayer was scratched with a sterile pipette tip, and then washed extensively to remove cellular debris. Wound healing was documented by photography at 24 h.

Invasion assay

Transwell chambers (SPL, Seoul, Korea) were used to assay cell invasion. Matrigel was applied to polycarbonate membrane filters with a pore size of 8mm. Cells were seeded in the upper part of a Transwell chamber at a density of 1×105/well in 100 ml of serum-free medium. The bottom chamber contained standard medium supplemented with 10% FBS. The chamber was then incubated in 5% CO2 at 37°C for 24 h. The filter in the upper well was removed. Finally, the attached cells in the lower section were stained with crystal violet and counted usinga light microscope.All experiments were performed in triplicate.

Statistical analyses

SPSS version 14 (SPSS, Chicago, IL, USA) was used to perform statistical analyses. Univariate analysis of the clinical/pathological variables and of HGF and c-Met expression were performed using the Pearson chi-squared test. In vitro data were analyzed by two-tailed Student’s t-test. Significant variables in the univariate analysis were included in a multinomial logistic regression test (multivariate analysis). P values <0.05 (*) and <0.01 (**) were considered statistically significant.