Supplementary protocols
cDNA amplification and labeling
mRNA from 8 to 10 µg of total RNA was extracted using oligo(dT) coated magnetic beads (Dynabeads, Dynal Biotech, Oslo, Norway) according to the manufacturer’s protocol. Then, 50 ng of isolated mRNA was fragmented according to Druart et al.(2007), and then incubated with 1µg of biotin-NotI-oligo(dT) primer (5´-Biotin-GAGGTGCCAACCGCGGCCGC(T)15-3’ at 70°C. Second-strand synthesis was performed for 2 h at 16°C with 40 U E. coli DNA Polymerase I (Fermentas, Vilnius, Lithuania), 10 U E. coli DNA Ligase (Invitrogen), 2 U E. coli RNaseH (Invitrogen), 0.2 mM dNTPs, 18.8 mM Tris-HCl (pH 6.9), 90.6 mM KCl, 4.6 mM MgCl2 and 10 mM (NH4)2SO4. Annealing of partially complementary 5’ PCR adaptor oligos (33 µM each of 5’-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT-3’, 5’PO4-ACCTGCCC-NH43’) was performed using a temperature ramp of 0.7°C min-1 from 50°C to 10°C. The PCR adaptors were subsequently ligated to the cDNA tags in a total volume of 40.8 µL, and 6 µL of cDNA tag eluate was PCR-amplified in a total volume of 100 µL using 3 U AmpliTaq DNA Polymerase (Applied Biosystems, Foster City, CA, USA) together with adaptor-specific primers (75 pmol each of 5´CCATCCTAATACGACTCACTATAGGGC-3’, 5’GAGGTGCCAACCGCGGCCGC(T)15-3’). PCR cycling was performed by incubating the reaction mixture at 95°C for 4 min, adding AmpliTaq, and then incubating at 95°C for 1 min and at 72°C for 5 min, followed by 23 amplification cycles of 95°C for 1 min, 50°C for 1 min and 72°C for 2 min. The optimal number of cycles (based on agarose gel electrophoresis of PCR samples)was determinedto be one or two cycles before PCR product saturation was achieved. The PCR products were purified using Chroma Spin +TE-200 columns (BD Biosciences) and eluted in 75 µL of 10 mM Tris-HCl, 1 mM EDTA according to the manufacturer’s protocol. Concentrations of the eluates were determined using a DNA quantification kit (PicoGreen, Molecular Probes).
Labeling of the cDNA tags was performed in a second PCR step using 150 ng of cDNA, 3 nmol of uracil-coupled fluorescent dye (Cy3- or Cy5-dUTP, Amersham Biosciences), 50 pmol of primer (5´-CCATCCTAATACGAC-TCACTATAGGGC-3’), 2 ng of amplified Lucidea Score Card Spike Mix (Amersham Biosciences) and 3 U of AmpliTaq DNA Polymerase (Applied Biosystems) in a volume of 50 µL, as described by (Druart et al., 2007). Unincorporated nucleotides were removed by purification on QIAquick PCR purification columns (QIAGEN) according to the manufacturer’s protocol, but using a phosphate washing buffer (5mM KPO4, 80% ethanol, pH 8.0) and elution buffer (4mM KPO4, pH 8.5). The labeled product was eluted in 41 µL, and then stored at -20°C.
Microarray Hybridization
Hybridization was performed in an automated slide processor (Lucidea ASP hybridization station, Amersham-Pharmacia Biotech). Prehybridization was performed for 30 to 60 min at 42°C in 5x SSC, 50% formamide, 2.5x Denhardt’s solution and 0.27 mg ml-1 BSA. The solution contained labeled cDNA (Cy3, Cy5), together with 5x SSC, 25% formamide, 0.22% SDS, 25 µg yeast tRNA and 30 µg oligo(dA80) in a total volume of 180 µL. The target was denatured for 3 min at 95°C and cooled on ice pending injection into a Lucidea Automated Slide Processor. After injection, the arrays were hybridized at 42°C for 13 to 16 h, followed by an iterative wash for 5-min in wash buffer I (0.8x SSC, 0.03% SDS), wash buffer II (0.2x SSC), and wash buffer III (0.05x SSC, 2 mM KPO4), before final air drying.