Supplementary Materials. Validation of ten candidate reference genes for qRT-PCR-based genes expression level assesment in nonfunctioning pituitary adenomas.
Bujko Mateusz, Natalia Rusetska, Mikula Michal
Patients
The analysis involved 30 patients with histopathologically confirmed nonfunctioning pituitary adenoma, who underwent surgeries at The Maria Sklodowska-Curie Memorial Cancer Centre and Institute of Oncology in Warsaw between years: 2010 and 2014. Patients provided informed consent for the use of tissue section for scientific purpose. The evaluation of candidate reference genes is a part of study that has been approved by the Independent Ethics Committee of the Cancer Centre and the Institute of Oncology. All patients were newly diagnosed with gonadotroph nonfunctioning pituitary adenoma and were treated surgically by endoscopic endonasal tumor resection and none of them were subjected to radiation therapy. Summary of patients’ characteristics in Supplementary Table 1.
Suppkementary Table 1. Patients' and sampes' characteristics.
Patient / Age (years) / Gender / Invasive / Atypical / Recurent / Tumor size(mm) / Immonohistochemistry
GH / PRL / ACTH / TSH / FSH / LH / α-su / MIB1
NFPA_1 / 37 / M / + / - / - / 29x33 / - / - / - / - / + / + / - / <1%
NFPA_2 / 58 / M / + / - / - / >10 / - / - / - / - / + / +/- / +/- / <1%
NFPA_3 / 72 / F / + / - / - / 24x23x30 / - / - / - / - / - / + / +/- / <1%
NFPA_4 / 39 / M / + / - / - / 24 / + / + / - / - / - / - / - / <3%
NFPA_5 / 59 / M / + / - / - / >10 / - / - / - / - / - / + / - / <3%
NFPA_6 / 61 / M / + / - / - / 27x28x28 / - / - / - / - / + / + / +/- / <1%
NFPA_7 / 60 / M / - / - / - / >10 / - / - / - / - / +/- / + / - / <1%
NFPA_8 / 34 / F / + / + / - / 27x34x33 / + / +/- / - / +/- / - / - / - / >3%
NFPA_9 / 56 / F / - / - / - / >10 / - / - / - / - / +/- / + / +/- / <1%
NFPA_10 / 49 / F / + / + / - / >10 / - / - / - / - / - / +/- / + / >3%
NFPA_11 / 68 / M / + / - / - / 27x32x43 / - / - / - / - / + / + / - / <1%
NFPA_12 / 62 / M / - / - / - / 19x23x21 / - / - / - / - / - / - / - / <1%
NFPA_13 / 74 / M / + / - / - / >10 / - / - / - / - / - / + / - / <1%
NFPA_14 / 57 / M / + / - / - / 39x25x21 / - / + / - / - / - / - / - / <3%
NFPA_15 / 49 / F / + / - / - / 32x22x29 / - / - / - / - / - / - / - / <1%
NFPA_16 / 71 / M / - / - / - / >10 / - / - / - / - / +/- / + / +/- / <3%
NFPA_17 / 71 / F / - / - / - / 15x15x20 / - / - / - / + / + / + / + / <1%
NFPA_18 / 49 / F / + / - / - / 30x25x30 / - / - / - / - / + / + / +/- / <3%
NFPA_19 / 60 / M / + / - / - / 49x28x25 / - / - / - / - / + / + / - / <1%
NFPA_20 / 58 / F / + / - / - / 30x23 / - / - / - / - / - / - / - / <1%
NFPA_21 / 75 / F / - / - / - / >10 / - / - / - / - / + / + / - / <1%
NFPA_22 / 54 / F / - / - / - / 20x26x19 / - / - / - / - / - / + / +/- / <1%
NFPA_23 / 73 / F / - / - / - / 25x25x36 / - / - / - / - / - / - / - / <1%
NFPA_25 / 74 / M / + / - / - / 35x24x31 / - / - / - / - / + / +/- / - / ~1%
NFPA_26 / 59 / M / - / - / - / 25x30x22 / - / - / - / - / + / + / - / <3%
NFPA_27 / 69 / M / - / - / - / >10 / - / - / - / - / + / + / +/- / <1%
NFPA_28 / 65 / M / + / - / - / 27x23x40 / - / - / - / - / +/- / + / +/- / <1%
NFPA_29 / 64 / F / - / + / - / 22x20x17 / - / - / - / - / - / + / - / >3%
NFPA_30 / 65 / F / + / - / - / 20x15x13 / - / - / - / - / - / - / - / <1%
NFPA_31 / 67 / F / - / - / - / 18x22x19 / - / - / - / + / + / + / + / <1%
Methods
Tissue samples were collected during endoscopic endonasal pituitary tumor resection. Part of the resected tissue underwent standard histopathological evaluation and the other part was frozen immediately in liquid nitrogen and stored in -70oC.
RNA was isolated with the use of Rneasy Plus Mini Kit (Qiagen), measured with Nanodrop 2000 Spectrophotometer (Thermo Scientific) and quality checked using Bioanalyser (Agilent). Only good quality samples that met the criteria of absorbance 260/280 ratio >1,8 according to spectrophotometric measurement and RIN >7 were included. One μg of RNA, from each sample, was subjected to reverse transcription using First Strand cDNA Synthesis Kit (Roche) according to manufacturer’s recommendations. RNA quality is reported in Suplementary Tanble 2.
Suplementary Tanble 2. RNA samples quality.
RNA samples qualityNumber of samples / 30
Absorbance 260/280 ratio
median / 2,09
range / 2,02 - 2,12
RNA Integrity Number
median / 8,7
range / 7 – 9,6
The PCR reaction was carried in 5 μL containing, 2x SensiMix II Probe mastermix (Bioline), 2.25 pmol of forward and reverse primer. Forty-five cycles of PCR amplification were performed using 7900 HT Fast Real-Time PCR System (Applied Biosystems) and 384-well plates format. Melting curveanalysiswere applied in each PCR reaction for the assesment of PCR specificity. Primers' sequences are listed in Supplentary Table 2.
Comparability of the qPCR assays was ensured by assesment of the qPCR efficiency. PCR efficiency was calculated based on the slope of standard curve that has been determined for each PCR assay using five step-wise x5 dillutions of cDNA obtained from the RNA from peripheral blood of healthy donor.
RefFinder, a comprehensive web-based tool (http://www.leonxie.com/referencegene.php) was used for evaluation of genes' expression stability. The evaluation is based on 4 implemented algorithms: geNorm [1], Normfinder [2], BestKeeper [3] and Comparative delta-Ct method [4] that represent different calculation approaches to assess the expression stability.
GeNorm calculate M stability value as the avarage pairwise variation of a particular gene with all control gene (standard deviation of the logarithmically transformed expression values of the compared genes). Gene with the lowest M stability value are considered as the most sstable. In this method step-wise elimination of the least stable gene lead to the selection of the two most stble genes recomanded for normalisation. [1]
In contrary to this pairwise comparison approach Normfinder ranks the candidate referenc genes based on the stability value that is calculated using a model-based approach based on inter- and intra-group gene expression variations. This is the most relevant when normalization is performed on heterogenous group of samples (for example when it includes tumor and normal control sections, or variable tumor subtypes). The lower stability value therefore indicate low intra- and intergroup variations and expression stability. [2]
Another approach, BestKeeper evaluation is based on Ct value descriptive statistics without log transformation to relative quantities (usually performed on qPCR data). In this method the expression stability is calculated based on standard deviation and coefficient of variation of Ct values for each candidate gene and is only initial step to eliminate unstable genes (SD<1). Subsequently, BestKeeper Index (BI) is created, which is the geometric mean of Ct values of candidate reference genes. A coefficient of correlation (r) to the BestKeeper Index (BI) is determined for each of particular candidate gene. The ranking of genes is based on coefficient of correlation. Gene with highest r reaches the top rank.
Comparative delta-Ct method is based on the comparison of delta- Ct values of all possible pairs of different candidate reference genes that is determined for each sample separately. In the comparison of samples, low delta- Ct standard deviation for particular pair of genes indicate stable expression whereas high deviation indicate that the expression of at least one of two genes is unstable within the group of samples. Expression stability of a particular candidate gene is calculated as average standard deviation from the comparisons, and the lower SD indicate higher expression stability. Average SD is used for the creation of genes’ ranking.
ReFinder comprehensive ranking is based on geometric mean of ranking values calculated with each algorithms separately
Suplementary Tanble 3. Primers' sequences.
Gene symbol / Forward primer (5' → 3') / Reverse primer (5' → 3')ACTB / AGAGCTACGAGCTGCCTGAC / AAGGTAGTTTCGTGGATGCC
B2M / TGCCGTGTGAACCATGTGA / GCTTACATGTCTCGATCCCACTT
GAPDH / GAAGATGGTGATGGGATTTC / GAGGTGAAGGTCGGAGTC
HMBS / TGCAACGGCGGAAGAAAA / ACGAGGCTTTCAATGTTGCC
HPRT1 / CGAGCAAGACGTTCAGTCCT / GGCGTCGTGATTAGTGATGAT
RPLP0 / GCAATGTTGCCAGTGTCTG / GCCTTGACCTTTTCAGCAA
SDHA / ACTGGATACTGAGCAGAAATGGAAT / CGAGGTTTTCACTTCACTGTTGA
TUBA1B / GCCTCCTAATCCCTAGCCAC / TCCAGGCAGTAGAGCTCCC
YWHAZ / GAAGCATTGGGGATCAAGAA / AGCAGATGGCTCGAGAATACA
UBC / ATTTGGGTCGCGGTTCTTG / TGCCTTGACATTCTCGATGGT
References:
1. Genorm: Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology 3 (7): :RESEARCH0034 2002
2. NormFinder: Andersen CL, Jensen JL, Orntoft TF. 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer research 64:5245-5250 2004
3. BestKeeper: Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnology letters 26:509-515 2004
4. The comparative delta-Ct method: Silver N, Best S, Jiang J, Thein SL. 2006. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC molecular biology 7:33 2006