Supporting Information

NMR structure and action on nicotinic acetylcholine receptors of water-soluble domain of human lynx1

Ekaterina N. Lyukmanova, Zakhar O. Shenkarev, Mikhail A. Shulepko, Konstantin S. Mineev, Dieter D’Hoedt, Igor E. Kasheverov, Sergey Filkin, Alexandra P. Krivolapova, Helena Janickova, Vladimir Dolezal, Dmitry A. Dolgikh, Alexander S. Arseniev, Daniel Bertrand, Victor I. Tsetlin, Mikhail P. Kirpichnikov.

NMR measurements and spatial structure calculation.

The NMR investigation was done using 0.5 mM samples of 15N-labeled or unlabeled ws-lynx1 in 5% D2O or 100% D2O. The pH adjustments were made via the addition of concentrated HCl or NaOH. All NMR spectra were measured using Bruker AVANCE-III 800 NMR spectrometer equipped with triple-resonance cryogenically cooled TXI probe. 1H chemical shifts were measured relative to the residual protons of H2O, the chemical shift of the signal being arbitrary chosen as 4.80 p.p.m. at 25 °C. 15N chemical shifts were referenced indirectly.

1H and 15N resonance assignments of ws-lynx1 were obtained at two pH values (5.3 and 3.4) by a standard procedure [S1, S2]. For this purpose 2D 15N-HSQC, 3D 15N-NOESY-HSQC, 3D 15N-TOCSY-HSQC, 2D DQF-COSY, 2D NOESY and 2D TOCSY spectra were analyzed in the CARA program [S3]. The 3JHNHα and 3JNHβ coupling constants were determined at pH 5.3 using 3D HNHA and 3D HNHB spectra [S4]. The 3JHαHβ and 3JHβHγ coupling constants were measured using ACME [S5] in the COSY spectrum of ws-lynx1 in 100% D2O solution (relaxation delay of 4 s, pH 5.3). Temperature coefficients of amide protons (Δδ1HN/ΔT) were measured at pH 5.3 over a temperature range 15 - 45ºC using 2D 15N-HSQC spectra. To identify amide protons which are in fast exchange with water, the 2D 15N-HSQC-CLEANEX-PM spectrum [S6] (τm=20 ms) was measured at pH 5.3. To identify slowly exchanging amide protons 15N-labeled sample of ws-lynx1 was lyophilized and dissolved in 100% D2O, pH 5.3. The H-D exchange kinetics at was measured using 2D 15N-HSQC spectra.

The summary of NMR data measured for ws-lynx1 at pH 5.3 and 25°C is presented in the Figure. S2.

The NMR data detects the presence of N-H∙∙∙N hydrogen bond between amide group of Asn16 and Nδ1 atom of imidazole ring of His5 (Figure 2C). The formation of this bond is supported by the observed NOE contacts and chemical shift of 1HN Asn16 signal, which is located at 11.1 ppm, close to the expected position of intrinsic HNδ1 proton of histidine ring (Figure 2A). The observation of second exchangeable proton (HNε2) of His5 ring at ~ 12.1 ppm further proves the ionization state (uncharged) of His5 side chain. The analysis of NMR spectra of the ws-lynx1 measured at pH 3.4 (Figure S3) indicated that the hydrogen bond HN Asn16 – Nδ1 His5 is present also at acidic (pH 3.4) conditions. This indicates that side chain of His5 has unusually low pKa value (< 3.4). The significant up-field shifts (0.8 – 1.0 ppm) observed for 1HN Asp3, 1HN Cys66 and 1HNε Arg19 upon change of pH value from 5.3 to 3.4 revealed presence of Asp3 – Oδ1 Asp70 and HN Cys66 – Oε1 Glu51 hydrogen bonds, and Asp3 – Arg19 salt bridge.

The spatial structure calculation was performed using the simulated annealing/molecular dynamics protocol as implemented in the CYANA software package version 2.1 [S7]. Upper interproton distance constraints were derived from NOESY (tm=80 ms) cross-peaks via a "1/r6" calibration. Torsion angle restraints and stereospecific assignments were obtained from J coupling constants and NOE intensities. Hydrogen bonds were introduced basing on temperature coefficients, water exchange rates, and deuterium exchange rates of HN protons. Amide protons demonstrating detectable H-D exchange kinetics (half-exchange time > 15 min, 25 ºC) and/or temperature coefficients less than 4.5 ppb/K were supposed to participate in hydrogen bonding. The disulfide bond connectivity pattern was established on the basis of observed NOE contacts [S8] and verified during preliminary stages of spatial structure calculation. In the final rounds of structure calculation lower distance constraints (3.0 Å), based on the expected cross-peaks but not present in the NOESY spectra with tm=100 ms, were introduced.

The structural statistics for the calculated set of ws-lynx1 structures are summarized in Table S2.

SI References

S1.  Wuthrich K. NMR of Proteins and Nucleic Acids. John Wiley and Sons, 1986, New York, USA

S2.  Cavanagh J., Fairbrother W. J., Palmer III, A.G., Skelton N.J., Protein NMR Spectroscopy principles and practice, Academic Press, London, 1996.

S3.  Keller, R.L.J, Wutrich K. Optimizing the process of nuclear magnetic resonance spectrum analysis and computer aided resonance assignment, Diss. Eth. No. 15947 (www.nmr.ch)

S4.  Bax A, Vuister GW, Grzesiek S, Delaglio F, Wang AC, Tschudin R, Zhu G. (1994) Measurement of homo- and heteronuclear J couplings from quantitative J correlation. Methods Enzymol. 239:79-105.

S5.  Delaglio F., Wu Zh. and Bax A. (2001) Measurement of Homonuclear Proton Couplings from Regular 2D COSY Spectra. J. Magn. Reson. 149:276-281.

S6.  Hwang TL, van Zijl PC, Mori S. (1998) Accurate quantitation of water-amide proton exchange rates using the phase-modulated CLEAN chemical EXchange (CLEANEX-PM) approach with a Fast-HSQC (FHSQC) detection scheme. J Biomol NMR. 11:221-6

S7.  Guntert P (2004) Automated NMR structure calculation with CYANA. Method Mol Biol. 278:353–378.

S8.  Arseniev AS, Kondakov VI, Maiorov VN & Bystrov VF (1984) NMR solution spatial structure of ‘short’ scorpion insectotoxin I5A. FEBS Lett 165, 57–62.

S9.  Wishart D.S., Sykes B.D. (1994) Chemical shifts as a tool for structure determination. Methods Enzymol. 239:363-392

SI Figures

Figure S1. Characterization of recombinant ws-lynx1. (A). SDS-PAGE analysis of ws-lynx1 biosynthesis and purified sample of refolded ws-lynx1: molecular mass marker (lane 1), BL21(DE3) cells lysate without ws-lynx1 gene expression (lane 2), BL21(DE3) cells lysate after ws-lynx1 gene expression (lane 3), sample of refolded ws-lynx1 after purification by HPLC (lane 4). Ws-lynx1 is indicated by arrow. (B). Analytical reverse-phase HPLC on Jupiter C4 column using a linear gradient (20-45% over 40 min, dotted line) of buffer B (100% acetonitrile in 0.1% trifluoroacetic acid) at flow rate of 2 ml/min. (C). MALDI-TOF mass spectrum of ws-lynx1. (D). CD spectrum of 0.05 mM ws-lynx1 in aqueous solution (pH 4.0). The content of secondary structure is 5.7% of α-structure, 39.4% of β-structure, 33% of random coil, 29.1% of β-turn.


Figure S2. Overview of NMR data defining the ws-lynx1 secondary structure in the aqueous solution (pH 5.3, 25°C). Hα chemical shift indices (CSIs), 3JHNHα coupling constants, temperature coefficients of amide protons (ΔδHN/ΔT), H-D exchange rates for HN protons (H⁄DEX), exchange rates of HN protons with water (H2OEX) and NOE connectivities are shown versus the ws-lynx1 sequence. The positive and negative values of CSIs denote β-strand and α-helical propensity, respectively [S9]. The large (> 8.5 Hz), small (< 5 Hz) and medium (others) 3JHNHα couplings are designated by the filled triangles, open squares and stars, respectively. The filled circles denote amide protons with temperature gradients less than 4.5 ppb/K. The filled, half-open and open circles denote HN protons with slow (half-exchange time > 24 h), slow-intermediate (half-exchange time > 1 h) and intermediate (half-exchange time > 15 min) H-D exchange rates, respectively. The filled squares denote amide protons which demonstrate fast exchange with water protons. The corresponding peaks were observed in 20 ms CLEANEX-PM spectrum. The NOE connectivities are denoted as usual. The widths of the bars correspond to the relative intensity of the cross-peak in the 80 ms NOESY spectrum. Elements of secondary structure are shown on a separate line; the β-strands are designated by arrows and tight b/γ-turns by wavy lines.


Figure S3. 15N-HSQC spectra of ws-lynx1, recorded at pH 7.0 (A), 5.3 (B) and 3.4 (C).

SI Tables

Table S1. Oligonucleotides used for ws-lynx1 gene construction.

Sequences 5’3’
1 / NdeI
GAGATATACATATGCTGGACTGCCACGTATGCGCATATAACGGCGATAACTGC
2 / GCAGTATGCTACCATTGCCGGGCAACGCATCGGGTTGAAGCAGTTATCGCC
3 / GTAGCATACTGCATGACTACTCGTACTTACTACACTCCGACTCGTATGAAA
4 / TACAGTCTCGAAGCAACGCGGTACACACGACTTCGATACTTTCATACGAGT
5 / TTCGAGACTGTATACGATGGCTACTCTAAGCACGCTTCCACCACCTCCTGC
6 / BamHI
GGCTCGGATCCCTATCAGCCGTTGCACAAATCGTACTGGCAGCAGGAGGTGGT

Overlapping regions are underlined. Restriction sites are shown in italic.

Table S2. Statistics for the best CYANA structures of ws-lynx1 at pH 5.3.

Distance and Angle restraints
Total NOE contacts / 438
intraresidual / 146
interresidual / 292
sequential (|i-j|=1) / 139
medium-range (1<|i-j|4) / 25
long-range (|i-j|>4) / 128
Hydrogen bonds restraints (28 bonds, upper/lower) / 56/56
S-S bond restraints (5 bonds, upper/lower) / 15/15
Lower distance restraints / 255
Torsion angle restraints / 116
Angle φ / 70
Angle χ1 / 44
Angle χ2 / 2
Total restraints/per residue: / 951/12
Statistics for calculated structures
Structures calculated/selected / 100/20
CYANA target function (Å2) / 2.0±0.25
Violations of restraints
Distance (>0.2 Å) / 0
Dihedral angles (>5 °) / 0
RMSD (Å)
Elements of secondary structure (3-47,62-74)
Backbone / 0.64±0.12
All heavy atoms / 1.32±0.14