B. Replication, Transcription, Translation

Unit 3 Test B Study Guide

On This Test:

A. DNA vs. RNA

C. Mutations

D. DNA Technology

Outline of main concepts. Fill-in the basic information for the concepts below AFTER completing this study guide) :

A. DNA vs. RNA

B. Replication, Transcription, Translation

C. Mutations

ex:

Part A: DNA vs. RNA

1. Name 3 differences between DNA and RNA: a.

2. Complete the following chart:

RNA / Job / Works with / Where
1. ______RNA (mRNA)
2. ______RNA (tRNA)
3. ______RNA (rRNA)

3. What is the base pairing rule for DNA? For RNA?

Part B: Replication/Transcription/Translation

4. Explain the process of DNA replication.

5. Why is it important for DNA to be replicated? When does replication occur?

6. Explain the process of transcription:

Why is transcription necessary? What type of RNA is formed from transcription?

7. Using the base pairing rule, write the correct mRNA strand that will be transcribed from the given DNA.

DNA: TACTTATCGGGCCCTAAGCTGC DNA: TACAACTGCTGAACCTGGTACG

8. What is a codon?

9. Where do you find codons?

10. Recall from Unit 1 that the monomers of proteins are amino acids. Using the genetic code key provided, (translate) write the amino acid that corresponds to the given DNA below (remember, you have to go to mRNA first!):

a. T A C G T T C A C G C A A A T A C T

b. T A C G G G T C A A A C G C A T T C C C C A T T

c. T A C G C A C A T G G A T T T T C A A T C

11. What is an anticodon?

12. Where do you find anticodons?

13. What would be the correct tRNA anticodon that would pair with each amino acid in (a) above?

14. Translation begins at AUG which is the ______codon.

15. Identify the steps of translation:

Part C: Mutations

16. What is a mutation?

17. Where do mutations occur?

18.What causes mutations?

Chromosomal Mutations
Name / Sketch

19. Correctly fill-in the following charts:

Gene Mutations
Name / Caused by / Sketch

20. Identify the following mutations as gene mutations or chromosomal mutations. If gene, tell whether it is a point or frameshift, as well as the type of mutation that CAUSED the point or frameshift. If chromosomal, tell whether it is a deletion, duplication, inversion, or translocation. Locate in each example where the mutation occurred.

d. ABCDE*FG → ABCDE*FGFG ______, ______

b. LMNO*PQ → LNO*PQ ______, ______

c. ACGGCGTTAACT → ACGGGTTAACT ______,______

d. 1234*56 → 1243*56 ______, ______

e. TACGGCATTGAG → TACGGGCATTGAG ______,______

f. GCTAACTAGAAT → GCTAAATAGAAT ______,______

Part D: DNA Technology

21. The picture above represents ______.

22. Letter A is called a(an) ______.

23. The main type of substance produced by the process is human ______.

24. What is the diagram above?

25. Which suspect(s) can be connected to the crime scene?

26. The diagram above was created by ______.

27. Which two types of cells are used in cloning?

28. Which type of cell actually provides the DNA being cloned?

29. All clones are ______.

30. The ______mapped all of the genes on

the human chromosome.