Applied Biochemistry and Biotechnology

Supplementary material

Comparative analysis of the effectiveness of C-terminal cleavage intein-based constructs in producing a recombinant analog of anophelin, an anticoagulant from Anopheles albimanus

Roman S. Esipov*, Maria A. Kostromina

Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, 16/10Miklukho-Maklaya St., 117997Moscow, Russia

*Corresponding author: e-mail address:; Phone:+7 495 3366833;Fax:+7 495 3307410.
Table S1. Oligonucleotide primers used to construct artificial anophelin gene.

Primer / 5'–3' sequence
Ano-Prim / GGTGGTTGCTCTTCCAACGCGCcg
Ano1 / GGTGGTTGCTCTTCCAACGCGCCGCAGTATGCGCCGGGCG
Ano2 / ATGAACCGTCTTATGATGAAGATACCGATGATTCTGATAAACTGGTGGAAAACGATACC
Ano3 / TCTATTACCGATGAAGATTATGCGGCGATTGAAGCGTCTCTGTCTGAAACCTTTAA
Ano4 / CACCGCGGCCGATCCGGGCCGTCGTCTGGGCGAAGG
Ano5 / CTCTAAACCGTAATTAGGATCCACCACC
Ano6 / GGTGGTGGATCCTAATTACGGTTTAGAGCCTTCGCCCAGACGACGGC
Ano7 / CCGGATCGGCCGCGGTGTTAAAGGTTTCAGACAGAGACGCTTCAAT
Ano8 / CGCCGCATAATCTTCATCGGTAATAGAGGTATCGTTTTCCACCAGTTTATCAGAAT
Ano9 / CATCGGTATCTTCATCATAAGACGGTTCATCGCCCGGCGCATACTGCG
Ano10 / GCGCGTTGGAAGAGCAACCACC
Ano-Revs / GGTGGTGGATCCTAATTACGGTTTAGAGCCTTCG

SapI and BamHI recognition sites are underlined, the stop codon is boldfaced

a /
b /

Fig.S1aConstruction scheme of pERIG expression vector. pTWIN1 and pERIG, the initial and resultant expression vectors; CBD, nucleotide sequence of chitin-binding domain; MxeGyrA, nucleotide sequence of MxeGyrA mini-intein; CBD-GyrA, fusion gene CBD-GyrA; MCS, multiple cloning sites; lacI, gene encoding lac repressor; rop, gene encoding Rop protein; Apr, gene encoding β-lactamase (Amp resistance); ori, origin of replication; M13 ori, origin of replication from bacteriophage M13. b Construction scheme of pERIG-Ano expression vector. pERIG and pERIG-Ano, initial and resultant expression vectors;Ano, nucleotide sequence of anophelin; GyrA-Ano, fusion gene GyrA-Ano.

a /
b /
c /

Fig.S2Optimization of cultivation conditions of E.coli strains producing fusion proteins DnaB-Ano(a), GyrA-Ano (b) and RIR-Ano(c). 15% -SDS-PAGE.Lanes 1–7, producer strains derived from E. coliER2566; lanes 8–14, producer strains derived from E. coliBL21(DE3). Lanes 1 and 8, uninduced crude cell extract; lanes 2–4 and 9–11, crude cell extracts after induction for 2, 3, and 4 h at 23С; lanes 5–7and12–14, crude cell extracts after induction for 2, 3, and 4 h at 37С. Arrows indicate fusion protein (A)andCBD-tagged mini-intein(B).

a / / e /
b / / f /
c / / g /
d / / h /

Fig.S3 Optimization of GyrA-Ano fusion protein cleavage.a – dcleavage after 48-h incubation at pH 6.0 (a), 7.0 (b), 8.0 (c), 9.0 (d)and 23 °С; e – h cleavage after 48-h incubation at pH 6.0 (e), 7.0 (f), 8.0 (g), 9.0 (h)and 37 °C. Lanes 1 purified GyrA-Ano; lanes 2 cleavage in the absencereducing agent; lanes 3cleavage in the presence of2 мМ DTT; lanes 4cleavage in the presence of10 мМ DTT; lanes 5cleavage in the presence of50 мМ DTT; lanes 6cleavage in the presence of0.5мМTCEP;lanes 7cleavage in the presence of 1 мМTCEP;lanes 8cleavage in the presence of5мМTCEP;lanes 9cleavage in the presence of50мМTCEP.Arrows indicate fusion protein GyrA-Ano (A)andCBD-tagged mini-intein CBD-GyrA (B).

a / / e /
b / / f /
c / / g /
d / / h /

Fig.S4 Optimization of RIR-Ano fusion protein cleavage.a – dcleavage after 72-h incubation at pH 6.0 (a), 7.0 (b), 8.0 (c), 9.0 (d)and 23 °С;e – h cleavage after 72-h incubation at pH 6.0 (e), 7.0 (f), 8.0 (g), 9.0 (h)and 37 °C.Lanes 1 purified RIR-Ano; lanes 2 cleavage in the absencereducing agent; lanes 3cleavage in the presence of2 мМ DTT; lanes 4cleavage in the presence of10 мМ DTT; lanes 5cleavage in the presence of50 мМ DTT; lanes 6cleavage in the presence of0.5мМTCEP;lanes 7cleavage in the presence of 1 мМTCEP;lanes 8cleavage in the presence of5мМTCEP;lanes 9cleavage in the presence of50мМTCEP.Arrows indicate fusion protein RIR-Ano (A)andCBD-tagged mini-intein CBD-RIR (B).

a /
b /
c / / d / / e / / f /

Fig.S5ESI-TOF mass spectrum ofanophelin fragment [2-61](a) and anophelin(b) from the DnaB-Anofusion proteinbefore deconvolution. DeconvolutedESI-TOF spectrum oftarget products after fusion proteinscleavage: anophelin fragment [2-61](c) and anophelin(d) from the DnaB-Anofusion protein,anophelin from GyrA-Ano(e) and RIR-Ano(f). The molecular massesof all target cleavage productscorrespond to the predicted masses ofanophelin(6537.73Da) and its fragment (6466.46 Da).