Supplementary Figures and Legends
Supplementary Figure S1
DNMT3B knockdown efficiencies in HeLa3rd and CaSki cell lines (a) qRT–PCR. (b) Western blot.
Supplementary Figure S2
(a) CpG sites analyzed by pyrosequencing. (b) The demethylation changes of PTPRR promoter (CpG site 12, 13 and 14) after DNMT3B knockdown in HeLa3rd cell line.
Supplementary Figure S3
PTPRR expression in HeLa3rd and CaSki cells after transfection with pT-REx-DEST31-PTPRR or pT-REx-DEST31 vector control. (a) qRT–PCR. (b) Western blot.
Supplementary Figure S4
(a) Strategy of the inducible system using TREx-HeLa cells transfected with pT-REx-DEST31-PTPRR. Withdrawal of doxycycline was used to mimic the knockdown of PTPRR. The addition of doxycycline was designated as 1, whereas withdrawal of doxycycline was designated as 0. P.0+0, no doxycycline; P.0+1, doxycycline at week 2; P.1+0, doxycycline at week 1 but not at week 2; P.1+1, doxycycline at weeks 1 and 2. (b) PTPRR expression using the system described in (a). (c) PTPRR expression did not affect cell growth in TREx-HeLa cells. Migration (d and e) and invasion (f and g) capabilities were suppressed after PTPRR reexpression and were restored after PTPRR withdrawal. The dotted line in (d) indicates the migration start site. Data in b, c, e and g are presented as the mean ± SD (n = 4). *p < 0.05.
Supplementary Figure S5
Changes in EMT markers in HeLa3rd (a) and CaSki (b) cells after PTPRR expression. Data in a–b are presented as mean ± SD (n=4). *p < 0.05.
Supplementary Figure S6
Changes in EMT markers in HeLa3rd (A) and CaSki (B) cells after DNMT3B downregulation. Data in a–b are presented as mean ± SD (n=4). *p < 0.05.
Supplementary Figure S7
Effects of the MAPK inhibitor, U0126, on MAPK signaling. After serum starvation for 16 h, cells were pretreated with U0126 (final concentration, 10 M) or DMSO without serum for 1 h and then stimulated with 10% (v/v) serum with U0126 or DMSO for 5 min for immunoblot analysis or 3 days for quantitative real-time PCR analysis. (a) Western blot analysis of p44/42 MPAK and AKT in U0126-treated cells. Gene expression analysis of Fra-1, c-Fos, c-Jun (b), E6, E7 (c) and CDH1 (d). Data in b–e are presented as mean ± SD (n=4). *p < 0.05.
Supplementary Figure S8
The proposed epigenetic-oncogenic regulatory loop promotes cancer metastasis. Methylation silencing of PTPRR activates p44/42 MAPK signaling, which results in the expression of AP-1 and the subsequent expression of HPV oncogenes (E6 and E7), and inhibits CDH1 expression. MAPK signaling may also augment the expression of DNMT3B. DNMT3B cooperates with DNMT1 to cause further de novo methylation of the PTPRR promoter and to maintain this methylation. Cell with oncogenic stresses may enter this vicious cycle through activated DNMTs or MAPK signaling.
Supplementary Tables and Legends
Supplementary Table 1. Genes demethylated after DNMT3B knockdown.
ABR / DKFZp434I1020 / KIAA0284 / LOC647135 / NBPF10 / SILVACPL2 / DPCR1 / KIAA1833 / LOC652203 / NBPF8 / SLC1A3
ADAMTS20 / DUB3 / KIAA1909 / LOC652924 / NBPF9 / SLC4A8
AKNA / DYRK1A / KRT5 / LOC653067 / NCOA1 / SLC6A14
AKR7A3 / EED / KRTAP9-4 / LOC653120 / OCM / SLFNL1
ASPHD2 / EEF1G / KRTHB1 / LOC653220 / OR1J2 / SLN
ATP12A / EFNA3 / KRTHB6 / LOC653266 / OR2T12 / SMA3
ATP6V0C / EHMT1 / L1CAM / LOC653273 / OR2T33 / SMAP1
AYTL1 / EIF4E3 / LCA10 / LOC653278 / OR2T8 / SMCP
B3GAT3 / EXOC5 / LCE1E / LOC653289 / PABPN1 / SNAPC1
B3GNT5 / FAM44C / LOC153561 / LOC653290 / PAGE1 / SRA1
BCAP29 / FAM72A / LOC23117 / LOC653294 / PCDH12 / SRI
BLCAP / FAM82A / LOC284861 / LOC653295 / PHGDH / SRP68
BMPR1A / FAM90A4 / LOC349196 / LOC653442 / PHYH2 / STAB1
BRUNOL4 / FAM90A5 / LOC375748 / LOC653449 / PKLR / STARD9
BTD / FGFR1OP / LOC387856 / LOC653453 / PMCHL1 / STK4
C11orf1 / FHL3 / LOC391609 / LOC653455 / PMCHL2 / STX16
C12orf58 / FLJ10120 / LOC391799 / LOC653535 / PNN / SYTL2
C14orf108 / FLJ11506 / LOC400558 / LOC653550 / PTCH / TAAR9
C14orf166B / FLJ20444 / LOC440905 / LOC653618 / PTPRR / TAL2
C15orf45 / FLJ40296 / LOC442208 / LOC653668 / PXMP2 / tcag7.1017
C17orf65 / FMO6 / LOC51149 / LOC653739 / RAB5B / THUMPD2
C1D / FRG1 / LOC641694 / LOC653801 / RBM11 / TIPARP
C1orf136 / GFOD1 / LOC641706 / LOC653820 / RBM19 / TLE1
C3orf33 / GLP1R / LOC642422 / LRRC7 / REXO1L1 / TMEM34
C6orf114 / GNAT1 / LOC642516 / LTA4H / REXO1L2P / TMEM5
C8orf17 / GOLGA8A / LOC642967 / MAGEB10 / REXO1L5P / TMOD1
C9orf19 / GP2 / LOC643045 / MAGEB2 / REXO1L6P / TMTC1
C9orf36 / GUSBL1 / LOC643052 / MAP4 / RFWD3 / TOMM34
C9orf91 / HIGD1B / LOC643666 / MAPK9 / RGS12 / TP53TG3
CCDC46 / HIST1H1B / LOC644312 / MAPKAPK3 / RNF111 / TRAPPC6B
CD55 / HIST1H3I / LOC644323 / MASP2 / RP11-114H20.1 / TSC22D1
CD8B / HIST1H4B / LOC644598 / MEST / RP11-138L21.1 / TTLL5
CENTD2 / ID1 / LOC644605 / MFI2 / RP11-262H14.4 / UGT2B28
CHML / IGKC / LOC644876 / MGC22265 / RP11-312O7.1 / UQCRB
CISH / IL7R / LOC645362 / MGC3123 / RP11-493K23.2 / UTP11L
CNNM3 / ITIH5 / LOC645974 / MGC39633 / RP6-166C19.1 / XAGE1
CNTNAP3B / JUN / LOC646579 / MGC72104 / SDCCAG10 / ZBTB7A
COL9A2 / KCNQ4 / LOC646652 / MSTO1 / SEMA6A / ZNF323
COX7B2 / KCTD5 / LOC646667 / MTPN / SENP1 / ZUBR1
CSTF2T / KGFLP1 / LOC646765 / N/A / SENP8
CYC1 / KGFLP2 / LOC647089 / NALP4 / SGPP2
DKFZp434B1231 / KIAA0125 / LOC647090 / NBPF1 / SH3RF2
Supplementary Table 2. List of genes annotated as development-related genes.
B3GNT5 / C14orf108 / FHL3 / MGC22265 / RGS12 / SYTL2BCAP29 / CHML / FLJ11506 / MTPN / SEMA6A / THUMPD2
BCAP29 / CISH / ID1 / PHGDH / SMA3 / TLE1
BRUNOL4 / COL9A2 / KRT5 / PTCH / SRI / TOMM34
BTD / DYRK1A / L1CAM / PTPRR / STAB1 / TRAPPC6B
BTD / EXOC5 / MEST / RAB5B / STX16 / UTP11L
Supplementary Table 3. Primers used in the present study.
Gene / Forward primer / Reverse primerCDH1 / CCCACCACGTACAAGGGTC / ATGCCATCGTTGTTCACTGGA
CDH2 / GGTGGAGGAGAAGAAGACCAG / GGCATCAGGCTCCACAGT
c-Fos / AAAAGGAGAATCCGAAGGGAAA / GTCTGTCTCCGCTTGGAGTGTAT
c-Jun / TCGACATGGAGTCCCAGGA / GGCGATTCTCTCCAGCTTCC
DNMT1 / GAGGAAGCTGCTAAGGACTAGTTC / ACTCCACAATTTGATCACTAAATC
DNMT3A / CTGAAGGACTTGGGCATTCAG / CACCATGCCCACCGTGA
DNMT3B / TACACAGACGTGTCCAACATGGGC / GGATGCCTTCAGGAATCACACCTC
Fra1 / CAGCTCATCGCAAGAGTAGCA / CAAAGCGAGGAGGGTTGGA
GAPDH / ACCCACTCCTCCACCTTTGACG / TCTCTTCCTCTTGTGCTCTTG
HPV16-E6 / AGGAGCGACCCAGAAAGTTACC / TCGCAGTAACTGTTGCTTGCA
HPV16-E7 / CCGGACAGAGCCCATTACAAT / TGCCCATTAACAGGTCTTCCA
HPV18-E6 / GGTGCCAGAAACCGTTGAATC / CGAATGGCACTGGCCTCTATAG
HPV18-E7 / CGAACCACAACGTCACACAAT / TGCTGGAATGCTCGAAGGT
MMP9 / TTGACAGCGACAAGAAGTGG / GCCATTCACGTCGTCCTTAT
PTPRR / CATGCTGGATGTAGAAGAAGACA / AACACCCTGTTCTACCTATTCCTG
PTPRR
(ChIP-qPCR) / AAGCTGGTGCTGGTTTCTGT / TGCTCTCCGCATAGTGTTTG
SLUG / AAGCATTTCAACGCCTCCAAA / AGGATCTCTCTGGTTGTGGTATGAG
SNAIL / AATCGGAAGCCTAACTACAGCG / GGTCCCAGATGAGCATTGGCA
TWIST / AGCTACGCCTTCTCGGTCT / TCCTTCTCTGGAAACAATGACA
VIMENTIN / GAACGCCAGATGCGTGAAATG / CCAGAGGGAGTGAATCCAGATTA
ZEB1 / CTACAACAACAAGACACTGCTGT / TGTTCTTTCAGAGAGGTAAAGCG
SIP1 / AACAACGAGATTCTACAAGCCTC / TCGCGTTCCTCCAGTTTTCTT
fibronectin / TGGGTGACACTTATGAGCGTC / TCCCACGTTTCTCCGACCA
Supplementary Materials and Methods
Patients
Cervical scrapings and tissues were from a hospital-based, retrospective, case-control study at the National Defense Medical Center, Taipei, Taiwan as described previously (1). Informed consent was obtained for all patients involved in this study and this study was approved by the Institutional Review Board of the Tri-Service General Hospital, Taipei, Taiwan. Cervical scraping DNA were collected on 338 patients, including women who had a normal uterine cervix (n = 161), CIN1 (n = 38), CIN2 (n = 39), CIN3 / CIS (n = 60), squamous cell carcinoma (SCC) or adenocarcinoma (AC) (n = 60). A cervical brush (Pap Brush; YoungOu, Gyeonggi-do, Korea) was used to collect cervical scrapings. The brush was preserved in phosphate-buffered saline solution at 4°C until DNA extraction. According to the logistics of our tissue banking (1), the DNA were extracted on a monthly basis. The storage of cervical brush at 4°C for 1 month does not compromise the DNA quality needed for genetic analysis such as mutations, polymorphisms, repeat sequences variations or DNA methylation. For DNA methylation analysis, the genomic DNA is further fragmented to avoid incomplete bisulfate conversion. The amplicons for QMSP are less than 200 base pairs. There is no limit of DNA quality in the present study. Cervical cancer tissue DNA were collected on 53 patients including women who had squamous cell carcinoma (SCC, n = 34) and adenocarcinoma (AC, n = 19). Cervical tissue RNA were collected on 23 patients including women who had normal uterine cervix (n = 7) and squamous cell carcinoma (SCC, n = 16). Cytological, histological and clinical data for all patients were reviewed by a panel of colposcopists, cytologists and pathologists. The uterine cervix diagnoses were according to histologic reports except normal uterine cervix scraping, which according to cytological reports. Normal cervixes in the tissue array and for RNA extraction were obtained from patients with benign gynecological diseases. The diagnoses were made by histopathology.
Cell lines, culture conditions, and constructs
The human cervical cancer cell lines HeLa3rd and CaSki were cultured in Dulbecco's modified Eagle's medium (DMEM) or RPMI 1640 medium containing 10% (w/v) fetal calf serum, penicillin at 100 U/ml, streptomycin at 100 g/ml, and l-glutamine at 2 mmol/l (all from Invitrogen). The process of selecting subline (HeLa3rd) is described below. The polycarbonate membranes (containing 8 mm pores) of the Transwell inserts (BD Bioscience, San Jose, CA, USA) that coated with Matrigel (BD Biosciences). HeLa cells were resuspended in DMEM containing 2% fetal calf serum and seeded into the wells. Following incubation for 72 h at 37 °C, the inserts were removed, and the cells that had migrated through the membranes and had become attached to the lower chamber were harvested and expanded for the second round of selection. The subline of the third-round selection was designated as HeLa3rd. DNMT3B RNAi (GATCCCCAGATGACGGATGCCTAGAGTTCAAGAGACTCTAGGCATCCGTCATCTTTTTTGGAAA. Sequences in underlined are RNAi sequence) (2) was cloned into pSuper vector (OligoEngine, Seattle, WA, USA) and transfected into cervical cancer cell lines, HeLa3rd and CaSki cells, with Lipofectamine 2000 (Invitrogen) in Opti-MEM I reduced-serum medium (Invitrogen, Carlsbad, CA, USA) at 37 °C in a 5% CO2 atmosphere for 4–5 h, after which the medium was removed and replaced with fresh culture medium. Cells were selected by antibiotic (G418) after 2 days in culture. Control cells were transfected with pSuper vector with scrambled RNAi. PTPRR (NM_130846) was constructed by inserting a full-length cDNA product into a pT-REx-DEST31 Gateway Vector (Invitrogen) using a TOPO Cloning Kit (Invitrogen). The construct was then transfected into HeLa3rd and CaSki cells with Lipofectamine 2000 (Invitrogen) in Opti-MEM I reduced-serum medium (Invitrogen) at 37 °C in a 5% CO2 atmosphere for 4–5 h, after which the medium was removed and replaced with fresh culture medium. Cells were selected by antibiotic (G418) after 2 days in culture. Control cells were transfected with pT-REx-DEST31 Gateway Vector only.
RNA extraction, cDNA synthesis, and quantitative real-time PCR
Total RNA was isolated from each sample using a Qiagen RNeasy kit (Qiagen , Hilden, Germany). An additional DNase I digestion procedure (Qiagen) was included in the isolation of RNA to remove contaminating DNA according to the manufacturer’s protocol. RNA was reverse transcribed to cDNA using the SuperScript III first-strand synthesis system for RT-PCR (Invitrogen) according to the manufacturer’s protocol. Oligo(dT) was used as the primer for RNA. Quantitative real-time PCR was performed using RT² SYBR Green qPCR Master Mixes (SABiosciences, Frederick, MD, USA) in an ABI 7500 Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA). Relative gene expression was determined based on the threshold cycles (Ct) of the genes of interest and the internal reference gene, GAPDH. The average Ct value of the GAPDH gene was subtracted from the average Ct value of the gene of interest for each sample, and the fold change was calculated (twofold per Ct). All values are expressed as mean ± SEM. The Mann–Whitney U test was used to compare relative RNA expression in the different stable transfectants or tissues. The primers used in this study are shown in Table S3.
Methyl-DNA immunoprecipitation coupled with microarray analysis
Ten micrograms of genomic DNA was dissolved in 90 l of nuclease-free water and fragmented into segments 300–500 bp with a Bioruptor (Diagenode, Denville, NJ, USA). Fragmented DNA (4 g) was diluted in 100 l of (final concentration) 0.15% SDS, 10 mM Na3PO4 pH 7.0, 1% Triton X-100, 150 mM NaCl, 1 mM EDTA pH 8.0, 0.5 mM EGTA pH 8.0, 10 mM Tris pH 8.0, 0.1% BSA, 7 mM NaOH with 30 g of anti-5-methyl cytosine antibody (ab1884; Abcam, Cambridge, UK), and the samples were rotated at 4 °C overnight. DNA–antibody complexes were collected after incubating with 120 l of Protein G Sepharose (Amersham GE) for 2 h at 4 °C with rotation. The Sepharose-bound complex was washed twice with 1 ml of low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris HCl pH 8.1, 150 mM NaCl), once with 1 ml high-salt buffer (0.1% SDS, 1% Triton X-100, 4 mM EDTA, 20 mM Tris HCl pH 8.1, 150 mM NaCl), lithium chloride buffer (0.25 M LiCl, 0.5% NP40, 0.5% deoxycholate, 1 mM EDTA, 0.5 mM EGTA, 10 mM Tris pH 8.0), and twice with 1 ml TE buffer (10 mM Tris-HCl and 1 mM EDTA, pH 8.0) for 10 min at 4 °C. The immunoprecipitate-enriched DNA was eluted with elution buffer (1% SDS and 0.1 M NaHCO3, freshly prepared), purified with phenol–chloroform, precipitated with ethanol, and dissolved in 40 l of Tris buffer (10 mM Tris-Cl, pH 8.5). The immunoprecipitated DNA was amplified using a whole-genome amplification kit (WGA2, Sigma) according to the manufacturer’s instructions. Amplified DNA was hybridized to HG18_promoter 2 array (Roche NimbleGen) with probe tiles from –3.75 to +0.75 kb of the transcriptional start sites. The labeling, array hybridization, scanning, and analysis were performed according to the manufacturer’s protocols (User Guide V1.0, Roche NimbleGen). The peak data for HeLa3rd/HeLa3rd+DNMT3B RNAi were analyzed according to the default sets of NimbleScan software V2.3 (Roche NimbleGen). The p-values were analyzed using log2 ratio and one-sided Kolmogorov–Smirnov (KS) test to determine whether the probes were drawn from a more significantly positive distribution of intensity than those in the rest of the array. The resultant p-value for each probe was expressed as –log10 and was visualized by SignalMap V1.9 (Roche NimbleGen).
Demethylation treatment, bisulfite modification, quantitative methylation-specific PCR (Q-MS-PCR), and bisulfite sequencing
Cells were treated with DMSO or 5-Aza-2-deoxycytidine (Sigma, St Louis, MO, USA) for the demethylation and gene reexpression analysis. Briefly, cells were treated with DMSO or 5-Aza-2-deoxycytidine (final concentration: 5–20 M) for 96 h, and the drug and medium were replaced every 24 h. DNA and RNA were extracted for further analysis after treatment. Bisulfite modification was performed using a CpGenome Fast DNA Modification Kit (Millipore, Bedford, MA, USA). Modified DNA was stored at –80 °C. qMS–PCR was performed in a TaqMan probe system using the LightCycler 480 Real-Time PCR System (Roche, Indianapolis, IN, USA). The type II collagen gene (COL2A) was used as the internal reference gene. Samples with a Cp value for COL2A greater than 36 were be defined as detection failures and were discarded. PCR products for bisulfite sequencing were cloned into yT&A vector (Yeastern Biotech, Taipei, Taiwan) and then sequenced. Primers and probe for qMS-PCR and bisulfite sequencing will be provided upon request.
Pyrosequencing analysis
Primers for pyrosequencing were designed by PyroMark Assay Design 2.0 software (Qiagen) to amplify and sequencing bisulfite-treated DNA. Briefly, the biotinylated PCR product was bound to streptavidin sepharose beads, washed, and denatured. After addition sequencing primer to single-stranded PCR product, pyrosequencing was carried out using PyroMark Q24 (Qiagen) and Pyro Q-CpG software (Qiagen) according to the manufacturer’s instructions. Primers for pyrosequencing will be provided upon request.
Chromatin immune precipitation assay
Chromatin immunoprecipitation (ChIP) assays were performed according to the protocol from Millipore (EZ-Magna ChIP G Chromatin Immunoprecipitation Kit). DNA was eluted with 100 l elution buffer, and 4 l was used per Q-PCR analysis. Quantitative PCR was performed using RT² SYBR Green qPCR Master Mixes (SABiosciences) in an ABI 7500 Real-Time PCR system (Applied Biosystems). The antibodies used in the ChIP-PCR analysis were anti-DNMT3b (ab13604, Abcam), anti-DNMT1 (ab16632, Abcam), and anti-mouse IgG (ab37355, Abcam). The primers used in this study are shown in Table S3.
Cell proliferation assay
Cells were seeded in 96-well plates at a density of 2000 cells/well. On days 0, 1, 2, 3, and 4, cell viability was measured using an MTS assay (C CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay, Promega, Madison, WI, USA) according to the manufacturer’s instructions. Briefly, the MTS reagent (20 l/ well) was added to 100 l of medium containing cells in each well of a 96-well plate, and the plate was incubated for 2 h. For the colorimetric analysis, the absorbance at 490 nm was recorded using a microplate reader. Experiments were repeated four times.
Cell migration and invasion assays
Cell migration assays were performed by using an Oris Universal Cell Migration Assembly kit, as instructed by the manufacturer (Platypus Technologies, Madison, WI, USA). Briefly, stoppers were inserted into each well before the cells were added, the cells suspended in culture medium were added, and the plate was incubated. After 24 hours, the stoppers were removed to allow the cells to migrate to a central detection zone (HeLa3rd cells for 24 h, CaSki cells for 16 h). The cells were then stained with Hoechst 33342 dye for 15 min (final concentration, 10 M). Images of each well were obtained, and cell migration was quantified by measuring the remaining cell-free surface area using ImageJ (3).
Cell invasion was measured in the Transwell system (BD Bioscience). The chamber membrane was coated with Matrigel (BD Bioscience). Twenty thousand cells were suspended in culture medium without serum and seeded in the upper chamber, and the same medium with serum was added to the lower chamber. After incubation (HeLa3rd cells for 24 h, CaSki cells for 16 h), cells that had permeated the Matrigel and migrated to the lower surface of the filter were fixed with methanol and stained with Giemsa’s azur eosin methylene blue solution (Merck, Darmstadt, Germany). The chambers were photographed under a microscope, and the cells in each chamber were counted. The number of transfected cells that migrated through the Matrigel was normalized by the mean cell counts of the control cell lines.
Immunoblot analysis
After serum starvation for 16 h, cells were treated with medium with 10% serum for 5 min. Cells were washed twice with PBS and lysed with M-PER (Thermo, Waltham, MA, USA) supplemented with protease inhibitors. Soluble proteins were boiled in SDS-sample buffer, separated by SDS-PAGE, and transferred to PVDF membranes (Millipore). The membranes were incubated with different primary antibodies and suitable secondary antibodies. Antigen–antibody complexes were detected using Immobilon Western Chemiluminescent HRP Substrate or Immobilon Western AP Substrate (both from Millipore). The antibodies used in the immunoblot analysis were anti-DNMT3B (ab16049, Abcam), anti-PTPRR (ab88598, Abcam), anti-phospho-p44/42 MAPK (Thr202/Tyr204) (9106, Cell Signaling), anti-p44/42 MAPK (9102, Cell Signaling), anti-phospho-AKT (Ser473) (9271, Cell Signaling), anti-AKT (9272, Cell Signaling), anti-β-actin (ab8226, Abcam).
In vivo tumorigenicity and metastasis models
Six-week-old CB-17 SCID mice were used in the tumorigenicity and metastasis analysis. All animal studies were approved by the Institutional Animal Care and Use Committee of the National Defence Medical Centre, Taipei, Taiwan. In the tumorigenicity analysis, 106 cells from each stable line were resuspended in 0.1 ml PBS and injected subcutaneously into both flanks of each mouse. The mice were sacrificed at day 30. Tumors were removed from the mice and weighed. To investigate the metastatic properties, 106 cells were suspended in 0.1 ml PBS and injected through the tail vein. Animals were sacrificed at the first sign of paralysis in the hind legs or respiratory distress, or after 12 weeks, and examined for the presence of metastases. The brain and lung were then excised, stained with Bouin’s fixative, and prepared for histopathological analysis.
Tissue microarray and immunohistochemistry
Paraffin-embedded cervical tissues of Chinese patients were retrieved from the Department of Pathology, National Defense Medical Center, Taiwan. The tissue microarrays comprised histologically normal squamous epithelial samples (n = 33), CIN1 (n = 15), CIN2 (n = 7), CIN3/CIS (n = 18), SCC (n = 53), metastatic SCC (n = 10). A standard protocol for immunohistochemistry was used with rabbit polyclonal anti-human PTPRR antibody (ab12153, Abcam).
Statistical analysis
SPSS (version 15) for Windows (IBM, Armonk, NY, USA) was used to analyze the data. The Mann–Whitney U test was used to compare cell proliferation, migration, invasion, and relative RNA expression and promoter methylation in the different stable transfectants or tissues. The significance of observed trends in methylation data of clinical swabs was determined by linear regression modeling by coding the diagnosis as an ordinal independent variable.
Reference
1.Lai HC, Lin YW, Huang RL, Chung MT, Wang HC, Liao YP, et al. Quantitative DNA methylation analysis detects cervical intraepithelial neoplasms type 3 and worse. Cancer. 2010 Jun 8.
2.Leu YW, Rahmatpanah F, Shi H, Wei SH, Liu JC, Yan PS, et al. Double RNA interference of DNMT3b and DNMT1 enhances DNA demethylation and gene reactivation. Cancer Res. 2003 Oct 1;63(19):6110-5.
3.Oh SJ, Santy LC. Differential effects of cytohesins 2 and 3 on beta1 integrin recycling. J Biol Chem. 2010 May 7;285(19):14610-6.
1