SUPPLEMENTARY MATERIAL
A New Alternariol Glucoside from Fungus Alternaria alternate (cib-137)
Guo-Bo Xu[a], b, Xiang Pua, Huan-Huan Baia, Xiao-Zhen Chena and Guo-You Lia*
aChengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, P. R. China; bSchool of Pharmacy, Guiyang Medical College, Guiyang, Guizhou 550004, P. R. China
A new secondary metabolite, 2-O-methylalternariol 4-O-b-[4-methoxyl- glucopyranoside] (1), together with four known compounds alternariol methyl ether (2), altenuene (3), isoaltenuene (4), and 2-(2′S-hydroxypropyl)-5-methyl-7-hydroxychromone (5), was isolated from the fungus Alternaria alternate cib-137. Its structure was elucidated on the basis of spectroscopic data. Compounds 3 and 4 demonstrated moderate activity against Staphylococcus aureus.
Key word: Alternaria alternate; Solid-state fermentation; Metabolites; Glucopyranoside alternariol
Contents Page
Experimental
Fungal material molecular identification 3
Figure S1: HRESI-MS Spectrum of Compound 1 4
Figure S2: IR Spectrum of Compound 1 5
Figure S3: 1H-NMR (600 MHz, Pyridine-d5) Spectrum of Compound 1 5
Figure S4: 13C-NMR (150 MHz, Pyridine-d5) Spectrum of Compound 1 6
Figure S5: HSQC (600 MHz, Pyridine-d5) Spectrum of Compound 1 6
Figure S6: HMBC (600 MHz, Pyridine-d5) Spectrum of Compound 1 7
Figure S7: NOESY (600 MHz, Pyridine-d5) Spectrum of Compound 1 7
Figure S8: HMBC and NOESY Correlations of Compound 1 8
Figure S9: 1H-NMR (600 MHz, Pyridine-d5) Spectrum of Compound 2 8
Figure S10: 13C-NMR (150 MHz, Pyridine-d5) Spectrum of Compound 2 9
Table S1: NMR Data of Compounds 1 and 2 9
Fungal material molecular identification
Identification of Alternaria alternate cib-137 was accomplished by the ribosomal internal transcribed spacer (ITS) method (Gardes Bruns 1993). Genomic DNA was prepared from fungal mycelium and extracted with gDNA isolation kit (E.Z.N.A. Fungal DNA Kit, OMEGA, Guangzhou, China). The genomic DNA (150 ng) was used as template to amplify the non-coding regions of the conserved regions of 18S, 5.8S and 28S rDNA by using the universal ITS primers ITS1 (5’-TCC GTA GGT GAA CCT GCG G-3’) and ITS4 (5’-TCC TCC GCT TAT TGA TAT GC-3’). The PCR amplification conditions consisted of 3 min at 95°C, followed by 35 cycles of 1 min at 92°C, 1 min at 50°C, and 2 min at 72°C; and with a final extension of 10 min at 72°C in an Eppendorf thermal cycler (Mastercycler pro 384, Hamburg, Germany). The PCR products were analyzed by agarose gel electrophoresis and purified by using a universal DNA purification kit (Tiangen Biotech Co., Ltd., Beijing, China). The purified products were ligated into a pGM-T vector (Tiangen Biotech Co., Ltd., Beijing, China) and the resulting construct was transformed into Escherichia coli DH5a competent cells (TransGene Biotech Co., Ltd., Beijing, China), according to the manufacturer’s introduction. The nucleotide sequences were sequenced on a 3730XL DNA sequencer (Applied Biosystem, USA). The resulting consensus sequence is as follows:
5’-TTCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCT
CTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA-3'
Comparison of the sequence with deposited sequences using BLAST resulted in 100% identity with the ITS regions of Alternaria alternata.
References
Gardes, M. Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Mol Ecol. 2: 113-118.
Figure S1: HRESI-MS Spectrum of Compound 1
Figure S2: IR Spectrum of Compound 1
Figure S3: 1H-NMR (600 MHz, pyridine-d5) Spectrum of Compound 1
Figure S4: 13C-NMR (150 MHz, pyridine-d5) Spectrum of Compound 1
Figure S5: HSQC (600 MHz, pyridine-d5) Spectrum of Compound 1
Figure S6: HMBC (600 MHz, pyridine-d5) Spectrum of Compound 1
Figure S7: NOESY (600 MHz, pyridine-d5) Spectrum of Compound 1
Figure S8: HMBC and NOESY Correlations of Compound 1
Figure S9: 1H-NMR (600 MHz, pyridine-d5) Spectrum of Compound 2
Figure S10: 13C-NMR (150 MHz, pyridine-d5) Spectrum of Compound 2
Table S1: 1H (600 MHz) and 13C (150 MHz) NMR data of compounds 1 and 2 (Pyridine-d5, d, ppm, J/Hz)a.
C atom / δH / δC1 / 2 / 1 / 2
1 / 105.1 / 100.2
2 / 165.7 / 166.3
3 / 7.44 (1H, overlap with H-5) / 6.78 (1H, d, 1.8) / 103.1 / 99.9
4 / 163.5 / 167.3
5 / 7.43 (1H, overlap with H-3) / 7.31(1H, d, 1.8) / 106.1 / 104.6
6 / 141.1 / 139.4
7 / 110.4 / 110.3
8 / 138.8 / 139.3
9 / 6.99 (1H, overlap with H-11) / 7.01 (1H, overlap with H-11) / 118.3 / 119.1
10 / 155.1 / 154.3
11 / 6.97 (1H, overlap with H-9) / 7.00 (1H, overlap with H-9) / 102.5 / 103.1
12 / 160.7 / 160.7
13 / 159.0 / 166.0
1′ / 5.51 (1H, d, 7.6) / 104.8
2′ / 4.02 (1H, t like) / 78.6
3′ / 4.38 (1H, overlap with H-6′) / 78.1
4′ / 3.81 (1H, t, 9.4) / 81.1
5′ / 4.44 (1H, t like) / 75.6
6′ / 4.21 (1H, dd, 11.8, 6.7)
4.39 (1H, overlap with H-3′) / 62.5
CH3-8 / 2.73 (3H, s) / 2.72 (3H, s) / 25.7 / 25.9
CH3O-2 / 3.87 (3H, s) / 56.1
CH3O-4′ / 3.85 (3H, s) / 61.1
CH3O-4 / 3.83 (3H, s) / 56.2
a. The assignment was succeeded on the basis of HSQC and HMBC experiments.
1
[a]Corresponding author. E-mail: ; Tel (Fax): 86-28-82890829