一、單選題（每題3分）

  1. PCR application is for

(A)Forensic DNA analysis

(B)Determining family relationship

(C)Study gene expression

(D)All of above

  1. What is the DNA sequence used by Sanger method?

(A)ATGTACGTCCAG

(B)GACCTGACTGTA

(C)GACCGTACTGTA

(D)ATGTCAGTCCAG

  1. Simple-sequence length polymorphism is used PCR with primers external to the repeat region. What do you see difference in length of amplified fragment on gel?

(1)ATCCTACGACGACGACGATTGATGCT



(2)ATCCTACGACGACGACGACGACGATTGATGCT



(A)I is sequence(1).

(B)II is sequence(1).

(C)I is sequence(2).

(D)(B) and (C).

  1. RNAi

(A)Double-stranded DNA is cleaved by the enzyme dicer into siRNA.

(B)RISC proteins bind RNAi and degrade one the two strands.

(C)Single-stranded siRNA bind to complementary sequences on mRNA.

(D)(B) and (C).

  1. Human gene is ______billion bp.

(A)2.9

(B)119

(C)1

(D)3

  1. Digest protein for human digestive aids.

(A)Amylase

(B)Protease

(C)Lipase

(D)All of above

  1. What’s it in above figure?

(A)Dialysis

(B)Centrifuge

(C)Dry

(D)None

  1. Eventually ______leads to cell senescence and death. Through mutations that affect the functions of different genes and expression of the enzyme telomerase, cancer cells can divide indefinitely and avoid senescence. Telomerase plays a role in this process by continually filling in telomere sequences to prevent them from shortening during cell division.

(A)Telomeres shortening

(B)Telomeres longer

(C)(A) and (B)

(D)None

  1. ______gene therapy involves isolating cells from the patient, introducing normal genes for the clotting protein into these cells, and then transplanting cells back into the body where these cells will produce the required clotting protein.

(A)Ex vivo

(B)In vivo

(C)In vitro

(D)All of above

  1. For isolating and culturing human embryonic stem cells (hESCs), cells isolated from the inner cell mass of human embryos can be grown in culture as a source of hESCs. Under the proper growth conditions, hESCs can be stimulated to ______into virtually any cell type in the body.

(A)differentiate

(B)proliferate

(C)(A) and (B)

(D)None

  1. Most Common Chemical Pollutants in the Environment for plastic manufacturing?

(A)Toluene

(B)Radioactive compounds

(C)Polyvinylchloride

(D)All of above

  1. A recombinant DNA plasmid construct containing an antifreeze protein gene promoter from ocean pout attached to the cDNA for salmon growth hormone can be used to produce rapidly growing fish for aquaculture. Transcription from the AFP promoter is stimulated by cold conditions; therefore transgenic fish containing this construct synthesize large amounts of growth hormone when they are raised in cool water. Increased production of growth hormones causes transgenic fish to grow faster than native nontransgenic strains. Bovine oocytes were incubated for 24 hours at 4°C in the absence (control) or presence of different types of AFPs or antifreeze glycoprotein (AFGP), a carbohydrate-rich type of AFP, and then fertilized with bovine sperm.

(A)AFPS as Cryoprotectants of Human Tissues

(B)The AFP- and AFGP-treated oocytes show fertilization rates similar to those of fresh oocytes.

(C)AFPs can provide cold protection of oocytes that will maintain their ability to be fertilized.

(D)All of above.

  1. This level is applicable to clinical, diagnostic, teaching, research, or production facilities in which work is done with indigenous or exotic agents which may cause serious or potentially lethal disease after inhalation.

(A)Biosafety level 1

(B)Biosafety level 2

(C)Biosafety level 3

(D)Biosafety level 4

  1. Biosafety level

(A)A biosafety level is the level of the biocontainment precautions required to isolate dangerous biological agents in an enclosed facility.

(B)The levels of containment range from the lowest biosafety level 1 (BSL-1) to the highest at level 4 (BSL-4).

(C)In the United States, the Centers for Disease Control and Prevention(CDC) have specified these levels.

(D)In the European Union, the same biosafety levels are defined in a directive.

(E)All of above.

  1. ______are all potential sources of stem cells.

(A)Human embryos

(B)Human fetal tissue, infants

(C)Human adults

(D)All of above

  1. In ______, the goal is to produce a cloned baby.

(A)therapeutic cloning

(B)reproductive cloning

(C)(A) and (B)

(D)None

  1. ______can be provide by infant.

(A)Cord blood stem cell

(B)Germ cell tumor

(C)Placental stem cell

(D)(A) and (C)

二、問答題（每題7分）

1. Compare a cDNA library versus a genomic DNA library. List one advantage about each library forcloning a gene.

2. Briefly describe and compare the following methodsof introducing DNA to cells.

(1) Electroporation

(2) CaCl2 treatment followed by heat shocking of cells at 42ºC

(3) Gene gun

3. If you plan to produce a recombinant protein which requires glycosylation for proper functions, which of the following organism will you choose for expressing this protein? Explain your choice.

(1) E. coli

(2) Tobacco

(3) Goat

4. The following techniques are designed for separating and analyzing proteins. What is the principle of each technique?

(1) Affinity chromatography

(2) Size-exclusionchromatography

(3) Ion-exchangechromatography

5. Do you think that bioprospecting, metagenomics or synthetic biology will be most fruitful for bringingabout useful strains of biotechnology? Explain your choice.

6. What are the benefits and harms that can come from genetically modifiedorganisms?

7. Which field of biotechnology will you be interested to participate in the future? Explain your choice.

第 1頁，共 6頁