pcDNA3.1 (-) / SPGFP
(SPGFP) / Restriction enzyme fragment (signal peptide sequence of Torsin A and EGFP) of pcDNAV5HisGFP-hTORA (XhoI/EcoRI) (kind gift from Prof. Dr. W. T. Dauer; 67) was ligated into pcDNA3.1 (-) (XhoI/EcoRI).
pcDNA3.1 (-) / SPGFP-Sun1-C
(DN-SUNL) / Restriction enzyme fragment (signal peptide sequence of Torsin A and EGFP) of pcDNAV5HisGFP-hTORA (XhoI/EcoRI) (kind gift from Prof. Dr. W. T. Dauer) was ligated into pcDNA3.1 (-) (XhoI/BamHI) together with the Sun1-C (amino acids 432-913) fragment (EcoRI/BamHI)
pCMV-Myc / KLC1 / 1-560 / PCR-product of KLC1-2-F: 5’ cggtcgaccatga caacatgtccacaatggtg 3’ and KLC1-2-R: 5' tagcggccgctcagttaaccagcccgagcttc 3’ was ligated in pCMV-Myc (SalI/NotI).
pCMV-Myc / KLC1 CT / 213-560 / PCR-product of TPR1-F: 5’ cggtcgaccc tgcggacgctccacaacct 3’ and KLC1-2-R: 5' tagcggccgctcagttaaccagcccgagcttc 3’ was ligated in pCMV-Myc (SalI/NotI).
pCMV-Myc / KLC1 T1-6 / 213-497 / PCR-product of KLC1 TPR1-F: 5’ cggtc gaccctgcggacgctccacaacct 3’ and KLC1 TPR6-R: 5’ tagcggccgcctaaccctgtttacgagacct catag 3’ was ligated in pCMV-Myc (SalI/NotI).
pCMV-Myc / KHC (KIF5B) / 1-963 / PCR-product of KIF5B-F: 5’ ccgaattcggatggc ggacctggccgagtgc 3’ and KIF5B-R: 5’ gggtcg acttacacttgtttgcctcctccacc 3’ (template: pXPE-KIF5B, kind gift of Prof. Dr. R. D. Vale) was ligated in pCMV-Myc (EcoRI/SalI).
pCMV-Myc / N2-SR / 6146-6799 / PCR-product of SR-2-F: 5’ cggtcgacccgctttg aggactggctcaagtc 3’ and SR-2-R: 5’ tagcggc cgctcacttgagaggaaggagcgctgtg 3’ was ligated in pCMV-Myc (SalI/NotI).
pEGFP-C2 / KLC1 / 1-560 / PCR-product of KLC1-F: 5’ gaattcatgtatgaca acatgtccaca 3’ and KLC1-R: 5’ ggatccgtcagtt aaccagcccgag 3’ was ligated in pGem-Teasy® and cloned in pEGFP-C2 (EcoRI/ BamHI).
pEGFP-C2 / N2-SR / 6146-6799 / See reference 19 for more details
pEGFP-C2 / N2-SR 2+3 / 6247-6656 / Restriction enzyme fragment of pGBKT-7 N2-SR 2+3 (EcoRI/BamHI) was ligated in pEGFP-C2.
pEGFP-C2 / N2-SR 2-3 / 6348-6552 / PCR-product of Nesp2 SR zw 2-3-F: 5’ ccga attctcctgcactccgggcttggaa 3’ and Nesp2 SR zw 2-3-R: 5’ gggtcgacgctacaaattttgttttattttgag cttattgt 3’ was ligated in pEGFP-C2 (EcoRI/ SalI).
pEGFP-C2 / SUN1 / 1-913 / See reference 15 for more details
pGADT-Rec / KLC1 / 1-560 / Y2H cDNA library clone
pGADT-Rec / KLC11-384 / 1-384 / Y2H cDNA library clone
pGADT-Rec / KLC1138-560 / 138-560 / Y2H cDNA library clone
pGADT-Rec / KLC1215-560 / 215-560 / Y2H cDNA library clone
pGBKT-7 / N2-SR / 6146-6799 / See reference 19 for more details
pGBKT-7 / N2-SR 1+2 / 6146-6347 / PCR-product of SR 1+2-F: 5’ cggtcgaccatga caacatgtccacaatggtg 3’ and SR 1+2-R: 5' tag cggccgctcagttaaccagcccgagcttc 3’ was ligated in pGem-Teasy® and cloned in pGBKT-7 (EcoRI/BamHI).
pGBKT-7 / N2-SR 2+3 / 6247-6656 / PCR-product of SR 2+3-F: 5’ gaattcgaagaatt tgagggcaccagg 3’ and SR 2+3-R: 5’ ggatccct gtcgtaagccccctctc 3’ was ligated in pGem-Teasy® and cloned in pGBKT-7 (EcoRI/ BamHI).
pGBKT-7 / N2-SR 3+4 / 6553-6799 / PCR-product of SR 3+4-F: 5’ gaattccaacagct gaactctgatatc 3’ and SR 3+4-R: 5’ ggatcccct gcaaggccattaaatc 3’ was ligated in pGem-Teasy® and cloned in pGBKT-7 (EcoRI/ BamHI).
pGEX-4T-1 / KLC1 / 1-560 / PCR-product of KLC1-2-F: 5’ cggtcgaccatga caacatgtccacaatggtg 3’ and KLC1-2-R: 5' tag cggccgctcagttaaccagcccgagcttc 3’ was ligated in pGEX-4T-1 (SalI/NotI).
pGEX-4T-1 / KLC1 NT / 1-212 / PCR-product of KLC1-2-F: 5’ cggtcgaccatga caacatgtccacaatggtg 3’ and KLC1-N-term-R: 5’ tagcggccgcctaccgcgcggggatctcgtag 3’ was ligated in pGEX-4T-1 (SalI/NotI).
pGEX-4T-1 / KLC1 T1-4 / 213-372 / PCR-product of KLC1 TPR1-F: 5’ cggtcgacc ctgcggacgctccacaacct 3’ and KLC1 TPR4-R: 5’ tagcggccgcctattttgtctggtagatctcgaggg 3’ was ligated in pGEX-4T-1 (SalI/NotI).
pGEX-4T-1 / KLC1 T1-6 / 213-497 / PCR-product of KLC1 TPR1-F: 5’ cggtcgacc ctgcggacgctccacaacct 3’ and KLC1 TPR6-R: 5’ tagcggccgcctaaccctgtttacgagacctcatag 3’ was ligated in pGEX-4T-1 (SalI/NotI).
pGEX-4T-1 / KLC1 CT / 213-560 / PCR-product of KLC1 TPR1-F: 5’ cggtcgacc ctgcggacgctccacaacct 3’ and KLC1-2-R: 5' tagcggccgctcagttaaccagcccgagcttc 3’ was ligated in pGEX-4T-1 (SalI/NotI).
pGEX-4T-1 / N2-SR / 6146-6799 / See reference 19 for more details
pGEX-4T-1 / N2-SR 1+2 / 6146-6347 / PCR-product of SR 1+2-F: 5’ gaattccgctttgag gactggctcaag 3’ and SR 1+2-R: 5’ ggatccaggt gagccgccggtggaa 3’ was ligated in pGem-Teasy® and cloned in pGEX-4T-1 (EcoRI/ EcoRI).
pGEX-4T-1 / N2-SR 2+3 / 6247-6656 / PCR-product of SR 2+3-F: 5’ gaattcgaagaatt tgagggcaccagg 3’ and SR 2+3-R: 5’ ggatccct gtcgtaagccccctctc 3’ was ligated in pGem-Teasy® and cloned in pGEX-4T-1 (EcoRI/ EcoRI).
pGEX-4T-1 / N2-SR 3+4 (pGEX-4T-1-K1) / 6553-6799 / See reference 19 for more details
pGEX-4T-1 / N2-SR 1 / 6146-6241 / PCR-product of Nesp2 SR1 F: 5’ ccgaattccgc tttgaggactggctcaagt 3’ and Nesp2 SR1 R: 5’ gggtcgacctacctctggttggtgaaatgcctg 3’ was ligated in pGEX-4T-1 (EcoRI/SalI).
pGEX-4T-1 / N2-SR 2 / 6247-6347 / PCR-product of Nesp2 SR2 F: 5’ ccgaattcgaa gaatttgagggcaccaggg 3’ and Nesp2 SR2 R: 5’ gggtcgacctaggtgagccgccggtggaac 3’ was ligated in pGEX-4T-1 (EcoRI/SalI).
pGEX-4T-1 / N2-SR 2-3 / 6348-6552 / PCR-product of Nesp2 SR zw 2-3 F: 5’ ccgaattctcctgcactccgggcttggaa 3’ and Nesp2 SR zw 2-3 R: 5’ gggtcgacctacaaattttgttttattttgagcttattgt 3’ was ligated in pGEX-4T-1 (EcoRI/SalI).
pTracerTM-EF/Bsd-B / SUN2 / 1-717 / See reference 17 for more details
Supplement Table 1