Title: a Nanostructured Genosensor for the Early Diagnosis of Systemic Arterial Hypertension

Supporting Information

Title: A nanostructured genosensor for the early diagnosis of Systemic Arterial Hypertension

Authors: ThalitaRolim, Juliana Cancino*, ValtencirZucolotto

Affiliations: Nanomedicine and NanotoxicologyGroup, Physics Institute of São Carlos, University of São Paulo, CP 369, 13560-970 São Carlos, SP, Brazil

*Juliana Cancino

e-mail address: or

Address: Nanomedicine and Nanotoxicology Group, Physics Institute of São Carlos, University of São Paulo, CP 369, 13560-970 São Carlos, SP, Brazil.

CEP: 13560-970 São Carlos, São Paulo, Brazil

Phone: +55 16 3373 8656

Table 1: Sequences of oligonucleotides

Oligonucleotide / Sequence
Capture probe / 5’Thiol-GAGAGCCACTCCCATCCTTTCTC3’
Target probe / 5’TTCAGAGCTGGAATAAAATTGGCGAAACCACA
TAAAAGTGACTGTATAGGCAGCAGGTCTAGAGA
AATGGGAGAAAGGATGGGAGTGGCTCTCCAG3’
Report probe / 5’Thiol- ACAGTCACTTTTATGTGGTTTCGCC3’

Figure S1: Gold nanoparticle size distribution. Percentage of gold nanoparticles without functionalization vs. size distribution. Size and zeta potential measurements were collected in 3 scans that were 180 seconds long using a Zetatracfrom Microtrac Inc.

Figure S2: TEM image of gold nanoparticles. Electronic microscope JEOL JEM-2100 operating at 200 kV. The images were taken at the Laboratory of Electron Microscopy atthe Laboratory National Synchrotron Light in Campinas, SP.

Figure S3: AuNP-DNA nanocomplexsize distribution. Percentage of gold nanoparticles functionalized with DNAvs. size distribution. Size and zeta potential measurements were collected in 3 scans that were 180 seconds long using a Zetatracfrom Microtrac Inc.

Figure S4. Real-Time PCR amplification. Fluorescence units (RFU) vs. amplification cycles. Control primer concentration of 0.3 µM with varying template DNA concentrations: 0.15 µM of template DNA (gray line) and 0.30 µM of template DNA (blue line). Nanocomplexes: 0.15 µM of template DNA with 0.30 µM of nanocomplexes (red line) and 0.30 µM of template DNA with 0.60 µM of nanocomplexes(pink line).

Figure S5:Nyquist plots of the genosensor recorded after hybridization of the target sequence (first hybridization) at different concentrations (1, 10, 20, 30 and 40 nM). AC perturbation voltage of 0.01V in the frequency range from 0.1 Hz to 10 kHz in a buffer solution (PBS, pH 7.4) containing 5 mM [Fe(CN)6]3−/4−. The red curve corresponds to the capture DNA+ME electrode surface before hybridization.

Figure S6: Confocal image of an unmodified gold electrode after exposure to ethidium bromide

1