The Creation of Active Human Factor X
Jessica Kettleson, Jordan Smith, Tracy Cronbaugh
University of Northern Iowa – Recombinant DNA Class
Final Summary Paper
Fall 2009
ABSTRACT
Factor X is important in the process of coagulation in living creatures and the absence of such often constitutes a life or death situation. High risk factors can be assumed if coagulation is not completed in an allotted amount of time. During the coagulation cascade, prothrombin is converted to thrombin by the active Factor X (Xa). If Xa is not present or created in blood, it is unable to clot and stop bleeding. Our attempt to clone Xa by using both mRNA and DNA and to create bacteria that produced Xa, was unsuccessful, but the creation and transformation of one exon, Exon 6, was successful. Great strides were taken to create the other two exons to later be ligated together to complete the Xa gene sequence, but our attempt was not completed.
INTRODUCTION
Coagulation is a process that most people fail to understand or appreciate. It is necessary for the vitality of animals and humans. In order to coagulate, Factor X (also known as the Stuart factor) is a necessity.The active Factor X protein (Xa) reacts with prothrombin to make thrombin. Thrombin, in the coagulation cascade (Figure A) (Raber), reacts with fibrinogen to make fibrin, the cross-linked building blocks that form a blood clot.
Factor X is located on Chromosome 13 and consists of over 26,000 bp and eight Exons. Xa consists of a portion of Exon 6, all of Exon 7 and all of Exon 8 for a total of 721 bp. The active gene sequence is as follows (Accession Numbers L00395, L00396, and N00045):
atcgtgggaggccaggaatgcaaggacggggagtgtccctggcaggccctgctcatcaatgaggaaaacgagg gtttctgtggtggaaccattctgagcgagttctacatcctaacggcagcccactgtctctaccaagccaagagattcaaggtgagggtaggggaccggaacacggagcaggaggagggcggtgaggcggtgcacgaggtggaggtggtcatcaagcacaaccggttcacaaaggagacctatgacttcgacatcgccgtgctccggctcaagacccccatcaccttccgcatgaacgtggcgcctgcctgcctccccgagcgtgactgggccgagtccacgctgatgacgcagaagacggggattgtgagcggcttcgggcgcacccacgagaagggccggcagtccaccaggctcaagatgctggaggtgccctacgtggaccgcaacagctgcaagctgtccagcagcttcatcatcacccagaacatgttctgtgccggctacgacaccaagcaggaggatgcctgccagggggacagcgggggcccgcacgtcacccgcttcaaggacacctacttcgtgacaggcatcgtcagctggggagagggctgtgcccgtaaggggaagtacgggatctacaccaaggtcaccgccttcctcaagtggatcgacaggtccatgaaaaccaggggcttgcccaaggccaagagccatgccccggaggtcataacgtcctctccattaaagtga
Discrepancies were found between the Xa sequence from mRNA (Accession Number K01886) and from the actual exon sequence found above. We chose to continue our project with that in mind, but for further analysis and PCR with exons, our sequence to order primers from was the sequence determined by the exons.
The primary goal of our project was to create a bacterial system that will produce the Xa protein in order to facilitate the reaction of prothrombin to thrombin in the coagulation cascade. We may then be able to test this protein and enter this part in the Biobricks library.
METHODS
RNA Methods:
Venous blood from one healthy volunteer was collected on several occasions into heparinized blood collection tubes as well as Yellow-Top (Type A) BD Vaccutainer tubes by trained phlebotomy personnel.
We began by following the RNA Isolation from Human Peripheral Blood protocol created by GMB (Genomic Medicine Biorepository). We then ran a Formaldehyde Agarose (FA) gel (Pitra) to verify that our RNA isolation worked. Gel ran at 70 volts for one hour.
The same RNA Isolation protocol was completed again, making small corrections to the initial procedure. Changes included maintenance of an RNAse free working environment, careful follow-through of protocol precisely as stated (e.g. allowing RBC lysis buffer to fully lyse the cells), and thorough performance of all steps (did not omit ethanol washing steps as did in first attempt).
After obtaining a small, visible white pellet of RNA in three of four tubes via isolation, we continued by adding 50 µl of RNAse-free water to each of the four tubes in order to elute the pellets. Our RNA samples were then run through an FA gel prepared as before for verification.
After confirmation of RNA by FA gel, we ran four reactions through a RT-PCR using the Qiagen One Step RT-PCR Protocol to create many copies of the double stranded DNA from mRNA to later use in transformation. The reaction consisted of two samples with 1 µl of RNA and another two samples with 5 µl of RNA. The following two primers were added to the master mix for our RT-PCR.
Forward Primer #1:
5’ TCTAGATGATCGTGGGAGGCCAGG 3’
Reverse Primer #1:
5’ TGATCACTTTAATGGAGAGGACGTT 3’
After RT-PCR, all samples, along with the pBluescript vector, were placed through a restriction digest, using the SpeI and XbaI restriction enzymes, to cut both ends for later ligation. The vector was purified using the Qiagen PCR Product Purification Kit and stored at -20ºC. To confirm success of the RT-PCR and restriction digest, all samples were run on a 1.0% agarose gel. Bands were cut and purified with the Qiagen Gel Extraction Purification Kit.
The gel electrophoresis that was run in order to determine if there was any DNA present in our sample was unsuccessful. In order to continue with this aspect of the project we needed to find DNA in our sample so that it could be purified and put through another PCR with additional primers. As a result of this set-back, we proceeded with our experiment by using DNA instead of RNA as our source for obtaining the Xa gene sequence.
DNA Methods:
We first isolated and purified the DNA by using the DNeasy Blood and Tissue Kit from Qiagen. We used human blood from the same volunteer that was used in our RNA isolation. We ran two samples with 100 µl of blood each. During elution we added 200 µl of Buffer AE twice to make four different samples in 1.5 ml microcentrifuge tubes. Samples 1 and 2 were from the first elution and samples 3 and 4 were from the second elution. We then ran a 1.0% agarose gel to verify that our DNA isolation worked.
We ordered primers to amplify out our Exons 6 and 8, with overhangs that included parts of Exon 7 to complete a jump template PCR (Figure B):
Figure B: Jump Template PCR Diagram
With these overhangs, we planned to do a second PCR by using our Exons 6 and 8 with the overhangs as primers to amplify out Exon 7, which in total would be our whole Xa sequence.
We ordered the following primers (the primer number corresponds to the diagram above):
Primer 1 (this includes three random base pairs which allow XbaI restriction enzyme to attach, the XbaI restriction site, a start codon since the start codon is included in the full Factor X gene, but not our Xa sequence, and the first 20 bp of Exon 6):
ttatctagatgatcgtgggaggccaggaat
Primer 2 (last 20 bp of Exon6 plus the first 20 bp of Exon 7, all in reverse complement):
tcctcattgatgagcagggcctgccagggacactccccgt
Primer 3 (last 20 bp of Exon 7, plus first 20 bp of Exon 8):
gagattcaaggtgagggtaggggaccggaccacggagcag
Primer 4 (last 20 bp of Exon 8, plus SpeI restriction site, all in reverse complement):
actagtcactttaatggagaggacg
Primer #3 had ability to fold over and bind to itself (Integrated DNA Technologies), so for our PCR, we tested four different annealing temperatures (65°C, 59°C, 55°C and 50°C) to see which was the most ideal. We also tested two different amounts of DNA in our PCRS (10 µl vs. 1 µl) for a total of sixteen PCR products. Verification of all the PCR products was completed on a 1.0% agarose gel. Exon 6 and 8 were purified out of the gel using the Qiagen QIAquick Gel Extraction Kit.
Exon 6 and 8 were then used as our primers in a jump template PCR to amplify Exon 7 to achieve our full length Xa sequence. This would be possible due to the Exon 7 overhangs created in our first set of primers listed above. Seven PCR reactions were run:
1. 0.8µl of each Exon 6 and 8 with 5.0µl of DNA;
2. Negative control with Exon 6 and 8;
3. 0.8µl of Exon 6 and 8, as well as 0.8 µl of Primers 1 and 4 from above (used to try to isolate out the whole sequence including introns) with 5.0µl of DNA;
4. Negative Control with all of the same primers;
5. 2.0µl of each Exon 6 and 8 with 5.0µl of DNA;
6. 2.0µl of Exon 6 and 8 and Primers 1 and 4 with 2.0 µl of DNA
7. Positive Control
Annealing stage was set at 59°C. All PCR products were verified on a 1.0% agarose gel.
A second attempt at our template jump PCR used only Exons 6 and 8 as primers at 50°C, 53°C, and 55°C, as well as separate reactions using only primers 1 and 4 at the same temperatures. The amount of DNA template used in each was 5.0µl. Products were again verified on a 1.0% agarose gel.
Exon 7 is approximately 125 bp, so creation using seven oligo sets was also attempted (Figure C).
Figure C: Exon 7 Creation with Oligos
The following primers were ordered:
Primer 1: ctagagccctgctcatcaatgaggaaaacgagggtttctg
Primer 2: tggtggaaccattctgagcgagttctacatcctaacggcag
Primer 3: cccactgtctctaccaagccaagagattcaaggtgagggtag
Primer 4: gatcactaccctcaccttgaatct
Primer 5: cttggcttggtagagacagtgggctgccgttaggatgtag
Primer 6: aactcgctcagaatggttccaccacagaaaccctcgtttt
Primer 7: cctcattgatgagcagggc
To ligate the primers together, 2µl of each of the seven primers were placed in a PCR tube. PCR setup included a “Touch Down” protocol that started the ligation at 70°C and dropped 1°C every minute for 60 minutes. Ligation with the pBluescript vector was completed.
Transformation Methods:
We also wanted to gain experience with ligating a gene into a plasmid vector and inserting that plasmid vector into an E. coli cell to transform the resulting colony genetically. To ligate the cloned gene from Exon 6 and Exon 8 into a vector we used Promega pGem T-Easy Vector System Protocol and JM109 High Efficiency Competent Cells (E.coli DH5α). This system provides us with a color indicator. If the cells contain the plasmid we synthesized, it will turn white, if there isn’t a plasmid containing our gene, the colonies will remain blue.
The first transformations ran utilized the gene fragments for Exon 6 and Exon 8. For the vector ligation protocol, we used 0.5 µl of Easy Vector and 3.5 µl of PCR product. For transformation protocol, we added 10 µl of ligation product to 40 µl of cells.
The second transformation used Exon 7 and the same competent cells, but the pBluescript vector that we purified was used in place of the pGem T-Easy Vector System. Six samples were run including 5 µl of PCR product, 1 µl of PCR product, 7 µl of a 1:10 dilution of PCR product, 1 µl of a 1:10 dilution of PCR product, 7 µl of 1:10 dilution of vector and 1 µl of 1:10 dilution of PCR product. Dilutions were run to determine what concentration of PCR product worked more efficiently.
Two hundred micro liters of each transformation were plated on LB plus Ampicilin plates and were incubated at 37ºC for 24 hours. The numbers of blue and white colonies were recorded.
One white colony was inoculated into 5 ml of liquid LB media and 8 µl of Ampicilin. A total of six colonies from each of Exon 6 and Exon 8 plates were transferred into media. These were left in the incubator overnight shaking at 250 rpms at 37ºC. Growth was recorded from each tube.
Tubes that grew were used to make glycerol stocks by adding together 680 μL of cells along with 320 μL of glycerol. These are stored in -80ºC freezer.
The innoculum tubes that grew were also used to create minipreps using the Fermentas Gene Jet Plasmid Miniprep Kit to create purified plasmids.
To lyse the DNA fragments exon 6 and exon 8 out of the plasmid vector, we set up a restriction digest using the restriction enzyme, EcoRI, which can be found on both sides of our gene fragment in the plasmid. Seven microliters of DNA were combined with 1.0 μl of EcoRI.
To lyse the DNA fragments for exon 7 out of our PBluescript vector we used the restriction enzymes XbaI and SpeI We used the same amount of DNA as before, but we chose to use 0.5 μl of each enzyme.
All digests were verified on a 1.0% agarose gel. Ran for 30 mins at 150 volts.
Two samples from Exon 6 and two samples from Exon 7 were sent for sequencing (Iowa State University).
RESULTS
RNA Results:
We initially were under the impression that it was not going to be possible to use DNA, our first choice, to isolate the Xa gene that we were aiming to clone. At the time it was thought that using DNA sequences of the Xa gene was not ideal because the DNA of the entire Factor X gene has over 26,000 bp –far too much for PCR. We also knew that if we decided to work with DNA we would have to deal with a number of exons and attempt to ligate them together. It has become apparent that at that moment in time we did not do a substantial job researching because it turns out that DNA could in fact be used as our Xa consisted of only three exons - a substantial number for isolation. As a result of our initial lack of understanding of the factor X gene in DNA, we decided to obtain the gene from RNA, which provides 721 base pairs for PCR, a number that can be successfully run through the PCR machine.
One vital aspect to working with RNA is the degradation by ever-present RNAses. The keeping of an RNAse-free working environment is crucial to the successful extraction of RNA. RNAses are microorganisms that are found virtually everywhere—from the surfaces in which we work, to the air we breathe and the water we drink. They are nearly inescapable as they are not harmed even by autoclaving. Extra special care was taken throughout this aspect of our experiment in the hope that RNAses would not ruin our wanted sample of RNA. We had to quickly learn how to keep sterility in our work environment, using only RNAse free pipette tips, centrifuge tubes, and solutions. Diethyl pyrocarbonate (DEPC), a solution that binds to RNAses and disables their function was added to both our RBC lysis buffer and our PBS solution at a 1/100 ratio. When running a gel, we had to follow a specific protocol (Pitra), making sure that the entire gel assembly was RNAse free, including the solutions themselves.
Overall, the first attempt to extract RNA from human blood was unsuccessful. After working through the extraction process by following the protocol, we put our samples through a gel in order to confirm the presence of RNA. Unfortunately, our sample showed no evidence of RNA at all. If we did in fact isolate a small portion of RNA, it was less than 1 ng/µl because otherwise there would have been a visible band on our gel at roughly 750 base pairs.