Table S1Description of the soybean seed samples used for the qRT-PCR validation experiment
# / process / Stage/treatment / Sample description1 / Seed development / S1 / 1-2 mm in seed length, 8-13 DAF,early seed development
2 / S2 / 2-3 mm in seed length, 13-18 DAF, early seed development
3 / S3 / 3-4 mm in seed length, 18-23 DAF, early seed development
4 / S4 / 4 -5 mm in seedlength, 23-27 DAF, early seed development
5 / S5 / 5 -6 mm in seedlength, 27-31 DAF, early seed development
6 / S6 / 6-7 mm in seedlength, 31-35 DAF, middle seed development
7 / S7 / 7-8 mm in seedlength, 35-39 DAF, middle seed development
8 / S8 / 8 -9 mm in seed length, 39-42 DAF, middle seed development
9 / S9 / 9 -10 mm in seedlength, 42-46 DAF, middle seed development
10 / S10 / 10 -11 mm in seedlength, 46-50 DAF, middle seed development
11 / S11 / 11 -12 mm in seed length, 50-53 DAF, late seed development
12 / S12 / 12 -13 mm in seed length, 53-57 DAF,late seed development
13 / Seed germination / Untreated
seeds / Dry seeds
14 / Imbibed for 3 hr on water
15 / Imbibed for 6 hr on water
16 / Imbibed for 9 hr on water
17 / Imbibed for 12 hr on water
18 / Imbibed for 15 hr on water
19 / Imbibed for 18 hr on water
20 / Imbibed for 21 hr on water
21 / Imbibed for 24 hr on water
22 / Seedlings with 5 mm in length of primary roots
23 / Treated
seeds / Imbibed for 12 hr on 10 μM ABA solution
24 / Imbibed for 18 hr on 10 μM ABA solution
25 / Imbibed for 24 hr on 10 μM ABA solution
26 / Imbibed for 12 hr on 10 μM fluridon solution
27 / Imbibed for 18 hr on 10 μM fluridon solution
28 / Imbibed for 24 hr on 10 μM fluridon solution
29 / Imbibed for 12hr on 5 μM GA3 solution
30 / Imbibed for 18 hr on 5 μM GA3 solution
31 / Imbibed for 24 hr on 5 μM GA3 solution
32 / Imbibed for 12hr on 10μM paclobutrazol solution
33 / Imbibed for 18 hr on 10 μM paclobutrazol solution
34 / Imbibed for 24 hr on 10 μM paclobutrazol solution
Table S2Genes and primers information of this study
Gene symbol / NCBIAccession NO. / Transcript name / forward primer / reverse primer / Amplicon
(bp) / PCR
efficiency / R2 / Primer
source
Seed specific
genes / Glyma02g11540 / XM_003518655.1 / Glyma02g11540.1 / TCTGGGAATGTTGGAATTAAGC / CCTAGAATGCCTTAGCACATCC / 112 / 1.10 / 0.997 / this study
Glyma05g37470 / AK286224.1 / Glyma05g37470.1 / TTCCACCTCGCAACCATGAT / CGAAGCAAACTCCCTCTTGG / 82 / 0.96 / 0.999 / this study
Glyma11g16250 / XM_003538014.1 / Glyma11g16250.1 / TTGCTTGAGGGAGAAGATGAG / TTCCATATGCTGCAATCTGTAC / 118 / 0.97 / 0.999 / this study
Soybean
orthologs / Glyma05g27480 / XM_003524822.1 / Glyma05g27480.1 / CTTAAAAGACCTGTAGTTTGAGCA / ACACATTACTAAAGGGCCAAAG / 103 / 0.97 / 0.999 / this study
Glyma08g28550 / XM_003531858.1 / Glyma08g28550.1 / CTGGGCAAAAAGAACTGAAT / AACTGAACTGACTAACAATTCGG / 95 / 1.03 / 0.996 / this study
Glyma15g11810 / XM_003547221.1 / Glyma15g11810.1 / CCGAACACACATTCTTTCAGC / GATCGTTGGGCTTCATTCTG / 106 / 1.04 / 0.999 / this study
Glyma18g04130 / XM_003552823.1 / Glyma18g04130.1 / ATCATGAGTGAACAAAAAGGTTC / AGTCTGAAACAAACTCTCGCC / 142 / 0.98 / 0.999 / this study
Classic HKGs / ACT2/7 / XM_003523194.1 / Glyma04g39380.1 / AATTCACGAGACCACCTACAAC / TGAGCCACCACTAAGAACAATG / 91 / 0.91 / 0.999 / Hu et al.2009
ACT11 / AK285830.1 / Glyma18g52780.1 / ATCTTGACTGAGCGTGGTTATTCC / GCTGGTCCTGGCTGTCTCC / 126 / 0.90 / 0.999 / Hu et al.2009
CYP / XM_003540483.1 / Glyma12g02790.1 / ACGACGAAGACGGAGTGG / CGACGACGACAGGCTTGG / 130 / 0.96 / 0.999 / Hu et al.2009
EF1b / AK286947.1 / Glyma02g44460.1 / CCACTGCTGAAGAAGATGATGATG / AAGGACAGAAGACTTGCCACTC / 134 / 0.86 / 0.999 / Hu et al.2009
TUA5 / AK285207.1 / Glyma05g29000.1 / TGCCACCATCAAGACTAAGAGG / ACCACCAGGAACAACAGAAGG / 103 / 0.94 / 0.999 / Hu et al.2009
TUB4 / AK286413.1 / Glyma03g27970.1 / GGCGTCCACATTCATTGGA / CCGGTGTACCAATGCAAGAA / 111 / 0.95 / 0.999 / Hu et al.2009
UBQ10 / AK286898.1 / Glyma07g32020.1 / TCCCACCAGACCAGCAGAG / CACGAAGACGCAACACAAGG / 117 / 0.92 / 0.998 / Hu et al.2009
Soybean
references / SKIP16 / BT093958.1 / Glyma12g05510.1 / GAGCCCAAGACATTGCGAGAG / CGGAAGCGGAAGAACTGAACC / 60 / 0.90 / 0.999 / Hu et al.2009
UKN1 / XM_003537688.1 / Glyma12g02310.1 / TGGTGCTGCCGCTATTTACTG / GGTGGAAGGAACTGCTAACAATC / 74 / 0.86 / 0.999 / Hu et al.2009
UKN2 / XM_003528209.1 / Glyma06g04180.1 / GCCTCTGGATACCTGCTCAAG / ACCTCCTCCTCAAACTCCTCTG / 79 / 0.98 / 0.996 / Hu et al.2009
MTP / XM_003554127.1 / Glyma03g29350.2 / CGCTCCAAGTGCTCCTCATTAG / TGAAGTAACCGACGCCAACG / 78 / 0.90 / 0.999 / Hu et al.2009
Verifying genes / IFS2 / AF195799.1 / Glyma13g24200.1 / AATGTGCCCTGGAGTCAATCTG / GGCGTCACCACCCTTCAATAT / 121 / 1.00 / 0.999 / Gutierrez-Gonzalez el at.2010
GmABI5 / XM_003537019.1 / Glyma10g08370.1 / GAGCAAGAAAACAGGCATACAC / ATCGGCCAGAGCTAGTTTAAG / 92 / 0.92 / 0.999 / this study
Table S3 List of most stably expressed genes during seed early development based on microarray data.
Stably expressed genes were identified based on the coefficient of variation (CV) value which was calculated using microarray data of soybean seeds on SoyBase website ( Genes with a low CV value were more stably expressed ones. This value was calculated by dividing standard deviation by the average expression value. Genes chosen as putative reference genes from this list were indicated by ★
Rank / Gene / Mean value / SD / CV / ★1 / Glyma20g38380 / 1.00 / 0 / 0
2 / Glyma01g36160 / 5.00 / 0.577 / 0.115
3 / Glyma18g52280 / 3.14 / 0.378 / 0.120
4 / Glyma06g16240 / 4.43 / 0.535 / 0.121
5 / Glyma17g14520 / 4.43 / 0.535 / 0.121
6 / Glyma11g16250 / 5.14 / 0.690 / 0.134 / ★
7 / Glyma13g19490 / 5.14 / 0.690 / 0.134
8 / Glyma20g34880 / 72.14 / 10.254 / 0.142
9 / Glyma03g35740 / 4.00 / 0.577 / 0.144
10 / Glyma18g42350 / 4.00 / 0.577 / 0.144
11 / Glyma05g38560 / 5.43 / 0.787 / 0.145
12 / Glyma09g40260 / 3.29 / 0.488 / 0.149
13 / Glyma05g37470 / 23.00 / 3.464 / 0.151 / ★
14 / Glyma12g25500 / 6.29 / 0.951 / 0.151
15 / Glyma19g02370 / 5.86 / 0.900 / 0.154
16 / Glyma06g20030 / 3.43 / 0.535 / 0.156
17 / Glyma09g05110 / 3.43 / 0.535 / 0.156
18 / Glyma08g08700 / 13.43 / 2.149 / 0.160
19 / Glyma07g16120 / 7.00 / 1.155 / 0.165
20 / Glyma02g09390 / 5.71 / 0.951 / 0.166
21 / Glyma11g36990 / 5.71 / 0.951 / 0.166
22 / Glyma03g32990 / 4.14 / 0.690 / 0.167
23 / Glyma20g37240 / 4.14 / 0.690 / 0.167
24 / Glyma20g21970 / 19.71 / 3.302 / 0.168
25 / Glyma17g15010 / 7.57 / 1.272 / 0.168
26 / Glyma10g05790 / 45.29 / 7.740 / 0.171
27 / Glyma13g05900 / 4.57 / 0.787 / 0.172
28 / Glyma02g28210 / 6.57 / 1.134 / 0.173
29 / Glyma14g23520 / 5.14 / 0.900 / 0.175
30 / Glyma01g00610 / 2.14 / 0.378 / 0.176
31 / Glyma03g42530 / 2.14 / 0.378 / 0.176
32 / Glyma05g12880 / 2.14 / 0.378 / 0.176
33 / Glyma05g28300 / 4.29 / 0.756 / 0.176
34 / Glyma06g05100 / 2.14 / 0.378 / 0.176
35 / Glyma08g42880 / 2.14 / 0.378 / 0.176
36 / Glyma11g33810 / 2.14 / 0.378 / 0.176
37 / Glyma12g35170 / 2.14 / 0.378 / 0.176
38 / Glyma13g03840 / 2.14 / 0.378 / 0.176
39 / Glyma14g00510 / 2.14 / 0.378 / 0.176
40 / Glyma19g38070 / 2.14 / 0.378 / 0.176
41 / Glyma07g33860 / 93.14 / 16.497 / 0.177
42 / Glyma09g31170 / 4.43 / 0.787 / 0.178
43 / Glyma16g05500 / 13.14 / 2.340 / 0.178
44 / Glyma01g37450 / 7.71 / 1.380 / 0.179
45 / Glyma06g48290 / 3.86 / 0.690 / 0.179
46 / Glyma08g04710 / 3.86 / 0.690 / 0.179
47 / Glyma18g20720 / 3.86 / 0.690 / 0.179
48 / Glyma08g42910 / 12.43 / 2.225 / 0.179
49 / Glyma03g39670 / 2.71 / 0.488 / 0.180
50 / Glyma05g26590 / 2.71 / 0.488 / 0.180
51 / Glyma07g33370 / 2.71 / 0.488 / 0.180
52 / Glyma07g37630 / 2.71 / 0.488 / 0.180
53 / Glyma09g01330 / 2.71 / 0.488 / 0.180
54 / Glyma11g33380 / 2.71 / 0.488 / 0.180
55 / Glyma12g32100 / 2.71 / 0.488 / 0.180
56 / Glyma13g03400 / 2.71 / 0.488 / 0.180
57 / Glyma17g02090 / 2.71 / 0.488 / 0.180
58 / Glyma19g43320 / 2.71 / 0.488 / 0.180
59 / Glyma11g08760 / 5.29 / 0.951 / 0.180
60 / Glyma20g14220 / 5.29 / 0.951 / 0.180
61 / Glyma02g11540 / 122.00 / 22.136 / 0.181 / ★
62 / Glyma13g05120 / 11.71 / 2.138 / 0.183
63 / Glyma15g00900 / 10.00 / 1.826 / 0.183
Table S4 Expression stability of putative references based on coefficient of variation (CV) of Ct values. The coefficient of variation (CV) was calculated by dividing the standard deviation (SD) by mean Ct value. Genes with a low CV value were more stably expressed ones
Rank / Total samples / Seed development / Seed germinationGene / CV / Gene / CV / Gene / CV
1 / UBQ10 / 0.035 / EF1b / 0.019 / Glyma08g28550 / 0.023
2 / Glyma08g28550 / 0.039 / Glyma05g37470 / 0.037 / Glyma05g27480 / 0.025
3 / Glyma11g16250 / 0.045 / UKN2 / 0.039 / Glyma05g37470 / 0.029
4 / Glyma02g11540 / 0.046 / Glyma08g28550 / 0.040 / UBQ10 / 0.030
5 / Glyma05g27480 / 0.046 / Glyma05g27480 / 0.044 / Glyma18g04130 / 0.031
6 / Glyma18g04130 / 0.054 / UBQ10 / 0.044 / Glyma02g11540 / 0.033
7 / UKN2 / 0.062 / ACT11 / 0.044 / CYP / 0.040
8 / Glyma05g37470 / 0.062 / CYP / 0.046 / EF1b / 0.042
9 / Glyma15g11810 / 0.071 / TUB4 / 0.048 / Glyma11g16250 / 0.043
10 / CYP / 0.080 / ACT2/7 / 0.048 / UKN2 / 0.048
11 / MTP / 0.085 / Glyma11g16250 / 0.049 / Glyma15g11810 / 0.055
12 / ACT11 / 0.091 / TUA5 / 0.051 / UKN1 / 0.059
13 / UKN1 / 0.099 / Glyma15g11810 / 0.051 / MTP / 0.060
14 / EF1b / 0.103 / MTP / 0.058 / ACT11 / 0.066
15 / TUB4 / 0.108 / Glyma02g11540 / 0.065 / TUB4 / 0.070
16 / TUA5 / 0.120 / Glyma18g04130 / 0.065 / ACT2/7 / 0.073
17 / ACT2/7 / 0.140 / UKN1 / 0.065 / TUA5 / 0.096