Table S1. Oligonucleotides used in gel retardation experiments.

Name / Sequence (5’3’) / Application
5 A / TAGCCTCGGAGCTCTAGG / Amplification of fragment A in the gdh promoter region
3 A / TTAGGTTATCAATTTGTATCGCC / Amplification of fragment A in the gdh promoter region
5 B / GTGGCCAGGTTATATAACCAG / Amplification of fragment B in the gdh promoter region
3 B / CGGGCATTTAGGCTGG / Amplification of fragment B in the gdh promoter region
gdh1_sense / CAATTCCATTTGAGGGCGCTCAATTGTGGCCAGGTTATATAACCAGTCAG / Fragment 1 used in competition assays with gdh promoter region
gdh1_anti
sense / Complementary to gdh1_sense / Fragment 1 used in competition assays with gdh promoter region
gdh2_sense / GTGGCCAGGTTATATAACCAGTCAGTCAACTGGTCTCATTCGCTGGTCGG / Fragment 2 used in competition assays with gdh promoter region
gdh2_anti
sense / Complementary to gdh2_sense / Fragment 2 used in competition assays with gdh promoter region
gdh3_sense / TCAACTGGTCTCATTCGCTGGTCGGATGAATTTAATTAAAGAAGAGACTT / Fragment 3 used in competition assays with gdh promoter region
gdh3_anti
sense / Complementary to gdh3_sense / Fragment 3 used in competition assays with gdh promoter region
gdh4_sense / ATGAATTTAATTAAAGAAGAGACTTCATGCGAGTTACCGCGCGTTTTGGC / Fragment 4 used in competition assays with gdh promoter region
gdh4_anti
sense / Complementary to gdh4_sense / Fragment 4 used in competition assays with gdh promoter region
gdh5_sense / CATGCGAGTTACCGCGCGTTTTGGCGATACAAATTGATAACCTAAAGAAA / Fragment 5 used in competition assays with gdh promoter region
gdh5_anti
sense / Complementary to gdh5_sense / Fragment 5 used in competition assays with gdh promoter region
gdh6_sense / GATACAAATTGATAACCTAAAGAAATTTTCAAACAAATTTTAATTCTTTG / Fragment 6 used in competition assays with gdh promoter region
gdh6_anti
sense / Complementary to gdh6_sense / Fragment 6 used in competition assays with gdh promoter region
argC1_fwd / ACCTGCACTTCCAGGTGGTG / Amplification of the argC upstream region
argC1_rev / CTCCTGCGATTGCAACCTTGA / Amplification of the argC upstream region
argG3_fwd / ACCACTTAAAGCGCCCCTAG / Amplification of the argG upstream region
argG3_rev / GCAAGAACGATGCGGTTAGTC / Amplification of the argG upstream region
1_sense / ACCACTTAAAGCGCCCCTAGTTCAAGGCTTGTTAATCGCTTGTTAATGCA / Fragment 1 used in competition assays with argG upstream region
1_antisense / Complementary to 1_sense / Fragment 1 used in competition assays with argG upstream region
2_sense / GGCTTGTTAATCGCTTGTTAATGCAGGCAGGTAAGGTATAACCCGAGTGT / Fragment 2 used in competition assays with argG upstream region
2_antisense / Complementary to 2_sense / Fragment 2 used in competition assays with argG upstream region
3_sense / GGCAGGTAAGGTATAACCCGAGTGTTTTTTCGAGGAATACCAACCCTTTC / Fragment 3 used in competition assays with argG upstream region
3_antisense / Complementary to 3_sense / Fragment 3 used in competition assays with argG upstream region
4_sense / TTTTTCGAGGAATACCAACCCTTTCAACACAATAATTTTCTTTAAACATC / Fragment 1 used in competition assays with argG upstream region
4_antisense / Complementary to 4_sense / Fragment 4 used in competition assays with argG upstream region
5_sense / AACACAATAATTTTCTTTAAACATCCTTGCTGTCCACCACGGCTGGCAAG / Fragment 5 used in competition assays with argG upstream region
5_antisense / Complementary to 5_sense / Fragment 5 used in competition assays with argG upstream region
6_sense / CTTGCTGTCCACCACGGCTGGCAAGGAACTTAAAATGAAGGAGCACACCT / Fragment 6 used in competition assays with argG upstream region
6_antisense / Complementary to 6_sense / Fragment 6 used in competition assays with argG upstream region
7_sense / GAACTTAAAATGAAGGAGCACACCTCATGACTAACCGCATCGTTCTTGCA / Fragment 7 used in competition assays with argG upstream region
7_antisense / Complementary to 7_sense / Fragment 7 used in competition assays with argG upstream region
CysI_fwd1 / GTGTTTGAAGTTGCCTTTCGTG / Amplification of the cysI upstream region
CysI_rev1 / TCACCGTGAATATAATAGACCG / Amplification of the cysI upstream region
CysI_fwd2 / GATCGGTCTATTATATTCACGG / Amplification of the cysI upstream region
CysI_rev2 / TGGGGAGTTAATCCTTAAAGAG / Amplification of the cysI upstream region