Table S1 Characteristics of Five Varieties of Peach Fruit at the Fully Ripening Stage (S3)
Acyl-CoA oxidase 1 is involved in γ-decalactone release from peach (Prunus persica) fruit
Liping Zhang· Haiyan Li· Ling Gao· Yujie Qi· Wanyi Fu· Xiongwei Li· Xiang Zhou· Qikang Gao· Zhongshan Gao· Huijuan Jia
Supplemental material
Table S1 Characteristics of five varieties of peach fruit at the fully ripening stage (S3).
Table S2The peptides of protein extracted from fully ripe peach mesocarp of ‘HJ’ matched with the amino acid sequence of PpACX1and PpACX3 in the peach protein database identified by EASY-nLC 1000 nanoliter HPLC and Orbitrap Elite MS.
Table S3 Primers of PpACXs for real-time quantitative polymerase chain reaction (qPCR).
Figure S1 The appearance of the fruit of ‘HJ’ and ‘YL’ at four ripening stages. Numbers 0 to 3 after cultivar abbreviations refer to four ripening stages (immature stage, early ripening stage, physiological ripening stage and fully ripening stage), respectively.
Figure S2 Changes in expression of PpACX genes in mesocarp of peach ‘HJ’and ‘YL’ at different ripening stages.For each figure, data shown are means ±SE (n=3). In each figure, asterisksindicate significant differences in relative expression of PpACX1 at each ripening stage compared with S0 (*P <0.05; **P <0.01; Student’s t-test). Numbers 0 to 3 after cultivar abbreviations refer to four ripening stages (immature stage, early ripening stage, physiological ripening stage and fully ripening stage), respectively.
Figure S3The primary mass spectrum (A) and secondary mass spectrum (B) of the peptide segments of protein extracted from fully ripe mesocarp of the peach cv. ‘HJ’.
Figure S4SDS-PAGE of purified recombinant His-tagged PpACX1. Lane M, protein marker; lanes 1 and 2, SDS-PAGE of the purified recombinant PpACX1 (15 and 7.5 µg, respectively); lanes 3 and 4, BSA standard solutions (5.00 and 2.50 µg, respectively).
Figure S5The primary mass spectrum (A) and secondary mass spectrum (B) of the peptide segments of peach recombinant PpACX1.
Table S1Characteristics of five varieties of peach fruit at the fully ripening stage (S3).
Varieties / Fruit type / Flesh color / Biological status of accession / Flesh firmness (N) / Aromatic strength / Flesh textureaHJ / Peach / White / Improved cultivar / 7.0-10.0 / Strong / Soft melting
YL / Peach / White / Landrace / <7.0 / Strong / Soft melting
TG / Peach / White / Landrace / 13.0-16.0 / Intermediate / Hard melting
ZH / Peach / White / Landrace / ≥16.0 / Slight / Hard melting
ZN16 / Nectarine / White / Improved cultivar / ≥16.0 / Slight / Hardmelting
Variety abbreviations: HJ, Hu Jing Mi Lu; YL, Feng Hua Yu Lu; TG, Tai Gu Rou Tao; ZH, Zhong Hua Shou Tao; ZN16, Zhong Nectarine16. a According to Wang et al. (2005).
Table S2The peptides of protein extracted from fully ripe peach mesocarp of ‘HJ’ matched with the amino acid sequence of PpACX1and PpACX3 in the peach protein database identified by EASY-nLC 1000 nanoliter HPLC and Orbitrap Elite MS.
Note: In the column of accession, the numbers 1 and 3 refer to ACX1 and ACX3, respectively.
Table S3 Primers of PpACXs for real-time quantitative polymerase chain reaction (qPCR).
Gene name / Primer / Forward primer (5’ to 3’) / Reverse primer (5’ to 3’) / Product (bp)PpACX1 / y2510-2 / TGAATCAGTTGTGCCCGATG / CCTTTTGTTTCCCATATCCTGG / 203
PpACX2 / y2282-1 / GGAACTGATAGACGCTTTTGAT / ACCAATCCCTTGTTATGCCA / 169
PpACX3 / Y2439-1 / CTGATAATGTTGCTGCTGTGAGG / CTAGTGCTGAACTGAAGACCACG / 125
PpACX4 / Y5916-1 / ACTCTGAGGGCAAGGGAAACG / ATTAAACAAAGTTGTCCCGAGAGC / 242
PpACX5 / Y3524-1 / CTTGGGTGCTATGATGGGAATG / AGGAAAGACAGAAGGCTAGTGGG / 169
TEF2 / TEF2 / GGTGTGACGATGAAGAGTGATG / GGTGTGACGATGAAGAGTGATG / 129
Figure S1 The appearance of the fruit of ‘HJ’ and ‘YL’ at four ripening stages.
Figure S2 Changes in expression of PpACX genes (A, B) in mesocarp of peach ‘HJ’ and ‘YL’ at different ripening stages.
Figure S3The primary mass spectrum (A) and secondary mass spectrum (B) of the peptide segments of protein extracted from fully ripe mesocarp of the peach ‘HJ’.
Figure S4SDS-PAGE of purified recombinant His-tagged PpACX1.
FigureS5The primary mass spectrum (A) and secondary mass spectrum (B) of the peptide segments of peach recombinant PpACX1.