Table S1

Primer sets for PCR,andForced PCR-RFLPdetected in bovine IGF2gene

Primer name1 / Primer sequence (5’-3’)2 / AT (oC) 3 / SAF (bp)4 / FPR5 / Genotype (bp) 6
SNP1-3 Detecting / F: AGCGGCTGGCGTGTCTT / 58.7 / 656
R: AACCCGTTTGATTCCATCTC
SNP1 Genotype / F: TACTTCAGTGAGTAGCTCCCCGG (T<C) / 55.5 / 404 / Sma I, CCC^GGG
Digest 8 h at 30℃ / GG:383,21
GA: 404, 383,21
AA: 404
R: AACCCGTTTGATTCCATCTC
SNP2-3 Genotype / F:TGAAGCCGCAAGCGTGGGTGGGCTG (G<C) / 56.5 / 203 / Pst I, CTGCA^G
Digest 8 h at 37 ℃ / CC:176, 27
CT:203, 176, 27
TT:203
R: AACCCGTTTGATTCCATCTC
SNP4 Detecting / F: ATGGGCACGTATCTGTGGACT / 58.5 / 1138
R: ACGGCTGCGTCGGTTTAT
SNP4 Genotype / F: TGGGGGCGGGGGCTGCCCGGAGGACCCGC(CG) / 59.0 / 120 / Hha I, GCG^C
Digest 8 h at 37 ℃ / AA: 122
AG: 122, 92,30
GG: 92, 30
R: ACGGCTGCGTCGGTTTAT
SNPs Detecting / F: CACTCACGCTCACTGTCCCT / 60.8 / 1101
R: AGACAGGACGGTACAGGGAT

1 SNPs:SNP1: intron8G17A (ss#647298811);SNP2: intron8C220T(ss#647298816); SNP3:intron8 A221G (ss#647298818); SNP4: intron8 A1393G (ss#647298820).

2 F: Forward primer; R: Reverse primer.Squared nucleotides: mark nucleotide mismatches enabling the use of the selected restriction enzymes for discriminating sequence variations;Underlined nucleotides: mark recognition site for the restriction endonuclease

3AT=Annealing temperature.

4SAF=Size of amplification fragment.

5 FPR= Restriction enzyme used for Forced PCR-RFLP.

6 Genotype: genotype column: the genotyping results. Genotypes: SNP1-GG,SNP2-CC, and SNP3-AA are the wild type; SNP1-AA,SNP2-TT, and SNP3-GG are the mutanttype.

Table S2

Descriptions are listedof the SNPs in the bovine IGF2gene

SNPs1 / Variant type 2 / Variant location / No.3 / Amino acid change / DPS (nt)4
1 / G17A / Intron 8 / ss#647298811 / non-coding / 0
2 / C220T / Intron 8 / ss#647298816 / non-coding / 203
3 / A221G / Intron 8 / ss#647298818 / non-coding / 1
4 / A1393G / Intron 8 / ss#647298820 / non-coding / 1172

1 SNPs: SNP1: intron8G17A (ss#647298811);SNP2: intron8C220T(ss#647298816); SNP3:intron8 A221G (ss#647298818); SNP4: intron8 A1393G (ss#647298820).

2The location is indicated to initiation exon or intron.

3No.:database of single nucleotide polymorphism (dbSNP) number.

4DPS: Distance from previous SNP (nt).

Table S3

Genotypic and allelic frequencies (%), value of χ2 test and diversity parameter of bovine IGF2gene

SNPs 1 / Breed 2
(Number) / Genotype /Number/GF 3 / Allele/AF 4 / χ2 / He 6 / Ho 7 / Ne 8 / PIC 9
(HWE)5
1 / QC(723) / GG/204/28.28 / GA/256/35.35 / AA/263/36.36 / G/45.96 / A/54.04 / 60.0859/P<0.05 / 0.5033 / 0.4967 / 1.9870 / 0.3734
CH(94) / 94/100.00 / 0/0.00 / 0/0.00 / 100.00 / 0.00 / - / 1.0000 / 0.0000 / 1.0000 / 0.0000
2-3 / QC(723) / CC-AA/343/47.47 / CT-AG/241/33.33 / TT-GG/139/19.19 / C-A/64.14 / T-G/35.86 / 54.8236/P<0.05 / 0.5400 / 0.4600 / 1.8519 / 0.3542
CH(94) / 94/100.00 / 0/0.00 / 0/0.00 / 100.00 / 0.00 / - / 1.0000 / 0.0000 / 1.0000 / 0.0000
4 / QC(723) / AA/226/31.31 / AG/292/40.40 / GG/205/28.28 / A/51.52 / G/48.48 / 26.4245/P<0.05 / 0.5005 / 0.4995 / 1.9982 / 0.3748
CH(94) / 94/100.00 / 0/0.00 / 0/0.00 / 100.00 / 0.00 / - / 1.0000 / 0.0000 / 1.0000 / 0.0000

1SNPs: SNP1: intron8G17A (ss#647298811);SNP2: intron8C220T(ss#647298816); SNP3:intron8 A221G (ss#647298818); SNP4: intron8 A1393G (ss#647298820).SNP 2 and 3 are in complete linkage disequilibrium, therefore, SNP2 andSNP3 of the genotyping results is the same.

2 Breed: QC, Qinchuan cattle (QC, n=723); CH, Chinese Holstein (CH, n=94).

3 GF: Genotypic frequency.

4 AF: Allelic frequency.

5χ2(HWE): Hardy-Weinberg equilibrium χ2 value.*Hardy-Weinberg equilibrium (P0.05), Hardy-Weinberg disequilibrium (P<0.05).Values in bold indicate that the genotype distribution was not in agreement with the Hardy– Weinberg equilibrium (P<0.05).

6 He: gene heterozygosity.

7Ho: gene homozygosity.

8 Ne: effective allele numbers.

9 PIC: polymorphism information content.

Table S4

Estimated values of linkage equilibrium analysis for four SNPs in IGF2gene in studied populations

SNPs 1 / QC / CH
r2 / D' / r2 / D'
1/2 / 0.0890 / 0.4330 / 0.0000 / 0.0000
1/3 / 0.0890 / 0.4330 / 0.0000 / 0.0000
1/4 / 0.0260 / 0.1800 / 0.0000 / 0.0000
2/3 / 1.0000 / 1.0000 / 0.0000 / 0.0000
2/4 / 0.0790 / 0.3660 / 0.0000 / 0.0000
3/4 / 0.0790 / 0.3660 / 0.0000 / 0.0000
Mean / 0.2270 / 0.4630 / 0.0000 / 0.0000

QC, Qinchuan cattle (QC, n=723); CH, Chinese Holstein (CH, n=94).

1 SNPs: The estimated values of LD (r2 andD') between polymorphism pairs.

SNPs: SNP1: intron8G17A (ss#647298811);SNP2: intron8C220T(ss#647298816); SNP3:intron8 A221G (ss#647298818); SNP4: intron8 A1393G (ss#647298820).

Table S5

The haplotype and haplotype frequency for four SNPs in IGF2gene in studied populations

Haplotype / SNPs 1 / Frequency in population
1 / 2 / 3 / 4 / QC / CH
(n=723) / (n=94)
Hap 1 / G / C / A / A / 0.1667 / 1
Hap 2 / G / C / A / G / 0.1084 / -
Hap 3 / G / T / G / A / 0.0792 / -
Hap 4 / G / T / G / G / 0.186 / -
Hap 5 / A / C / A / A / 0.2313 / -
Hap 6 / A / C / A / G / 0.135 / -
Hap 7 / A / T / G / A / 0.038 / -
Hap 8 / A / T / G / G / 0.0554 / -
Total / 1 / 1

QC, Qinchuan cattle (QC, n=723); CH, Chinese Holstein (CH, n=94).

1 SNPs: SNP1: intron8G17A (ss#647298811);SNP2:intron8C220T(ss#647298816); SNP3:intron8 A221G (ss#647298818); SNP4: intron8 A1393G (ss#647298820).

1