Supplementary tables
Table S1. Primer pairs used for PCR screening
wsp / wspF: TGGTCCAATAAGTGATGAAGAAACTAGCTAa / Wolbachia / 65–55 TD / ~600
wspR: AAAAATTAAACGCTACTCCAGCTTCTGCACa
16S rDNA / 16STF1: GGTCTTCGGATTGTAAAGGTCTGb / Spiroplasma / 65–48 TD / ~973
16STR1: GGTGTGTACAAGACCCGAGAAb
16S rDNA / 10F: AGTTTGATCATGGCTCAGATTGc / Most bacteria / 60 / ~1500
1507R: TACCTTGTTACGACTTCACCCCAGc
16S rDNA / 27F: GAGAGTTTGATCCTGGCTCAGd / Most bacteria / 55 / ~1470
1492R: GGTTACCTTGTTACGACTTd
16S rDNA / 559F: CGTGCCAGCAGCCGCGGTAATACe / Most bacteria / 58 / > 1000
35R: CCTTCATCGCCTCTGACTGCe / (not Wolbachia)
coxA / coxAF: TTGGRGCRATYAACTTTATAGf / Wolbachia / 55 / ~487
coxAR: CTAAAGACTTTKACRCCAGTf
gatB / gatBF: GAKTTAAAYCGYGCAGGBGTTf / Wolbachia / 54 / ~471
gatBR: TGGYAAYTCRGGYAAAGATGAf
hcpA / hcpAF: GAAATARCAGTTGCTGCAAAf / Wolbachia / 53 / ~515
hcpAR: GAAAGTYRAGCAAGYTCTGf
fbpA / fbpAF: GCTGCTCCRCTTGGYWTGATf / Wolbachia / 59 / ~509
fbpAR: CCRCCAGARAAAAYYACTATTCf
ftsZ / ftsZF: ATYATGGARCATATAAARGATAGf / Wolbachia / 54 / ~524
ftsZR: TCRAGYAATGGATTRGATATf
a [22]; b [15]; c [39]; d [30] ;e [35]; f [4]; g TD = touch down; reducing 1°C per cycle until lowest annealing temperature is reached.
Supplementary Table S2. Host species, host order, and GenBank accession numbers for the Wolbachia sequences used in the phylogenetic analyses.
Host / Order / hcpA / coxA / fbpA / gatB / ftsZ /Aedes albopictus / Diptera / DQ842379 / DQ842268 / DQ842342 / DQ842416 / DQ842305
Adalia bipunctata / Coleoptera / -- / -- / -- / -- / EU627753
Acraea encedon / Lepidoptera / DQ842380 / DQ842269 / DQ842343 / DQ842417 / DQ842306
Acraea eponina / Lepidoptera / DQ842381 / DQ842270 / DQ842344 / DQ842418 / DQ842307
Acromis sparsa / DQ842382 / DQ842271 / DQ842345 / DQ842419 / DQ842308
Anastrepha striata / Diptera / JX000061 / JX000064 / JX000062 / JX000063 / JX000065
Aramigus tesselatus / Coleoptera / -- / -- / -- / -- / U28193
Armadillidium vulgare / Isopoda / DQ842383
-- / FJ390241
-- / DQ842346
-- / EF451562
-- / AJ223243
DQ842309
Brugia malayi / Spirurida / DQ842384 / DQ842273 / DQ842347 / DQ842421 / DQ842341
Bemisia tabaci / Hemiptera / HQ404794 / -- / -- / HQ404792 / EU627760
Celastrina agiolus / Lepidoptera / -- / EU127813 / -- / --
Chelymorpha altemans / Coleoptera / DQ842385 / DQ842274 / DQ842348 / DQ842422 / DQ842309
Cimex leculariusredo / Hemiptera / DQ842386 / DQ842275 / DQ842349 / DQ842423 / DQ842311
Colias eriate / Lepidoptera / -- / AB436686 / AB436690 / -- / --
Cepora nerissa / Lepidoptera / -- / -- / -- / -- / FJ392436
Camponotus pennsylvanicus / Hymenoptera / DQ842387 / DQ842276 / DQ842350 / DQ842424 / DQ842312
Culex pipiens / Diptera / DQ842389 / DQ842278 / DQ842352 / AM999887 / DQ842314
Culex quinquefasciatus / Diptera / AM999887 / DQ842278 / AM999887 / DQ842426 / AM999887
Calyptrate muscoid fly / Diptera / EU126323 / FJ969198 / FJ969201 / -- / --
Chloropidae sp. / Diptera / -- / EU126247 / -- / -- / --
Cubitermes sp. / Isoptera / -- / -- / EF417902 / -- / --
Diaphorina citri / Hemiptera / -- / -- / -- / -- / GU480077
Drosophila innubila / Diptera / DQ842391
-- / EU126219
DQ842280 / EU126381
DQ842354 / DQ842428
-- / DQ842316
--
Drosophila bifasciata / Diptera / DQ842390 / DQ842279 / DQ842353 / DQ842427 / DQ842315
Drosophila neotestacea / Diptera / EU126271 / EU126214 / DQ842355 / EU126157 / DQ842317
Drosophila orientacea / Diptera / DQ842393 / EU126228 / DQ842356 / DQ842430 / DQ842318
Drosophila recens / Diptera / DQ842394 / DQ842283 / DQ842357 / DQ842431 / DQ842319
Drosophila simulans / Diptera / DQ842395
DQ842397
DQ842398
CP001391 / DQ842284
FJ390242
DQ842287
CP001391 / DQ842358
DQ842360
DQ842361
CP001391 / DQ842432
DQ842435
DQ842433 / DQ842322
DQ842323
Drynid wasp / Hymenoptera / -- / GU289819 / -- / -- / --
Ellescus bipunctatus / Coleoptera / GU111708 / -- / -- / -- / DQ842324
Encarsia formosa / Hymenoptera / -- / DQ842288 / DQ842362 / DQ842436 / EU627767
Eurema hecabe / Lepidoptera / -- / -- / -- / -- / FJ392435
Ephestia kuehniella / Lepidoptera / DQ842400
DQ842401 / DQ842289
DQ842290 / DQ842363
DQ842364 / DQ842437
DQ842438 / DQ842325
DQ842424
Gryllus firmus / Orthoptera / DQ842402 / DQ842291 / DQ842365 / DQ842439 / DQ842327
Hypolimnas bolina / Lepidoptera / -- / -- / EF589956 / -- / --
Horaga onyx / Lepidoptera / -- / EU127600 / -- / -- / --
Hishimonoides sellatiformis / Hemiptera / -- / -- / -- / -- / AB073734
Ixias pyrene / Lepidoptera / -- / -- / -- / -- / FJ392428
Incisitermes snyderii / Isoptera / DQ842403 / DQ842292 / DQ842366 / DQ842440 / DQ842328
Jakmenus evagoras / Lepidoptera / -- / -- / -- / -- / FJ392434
Libythea myrrha / Lepidoptera / -- / -- / EU127812 / -- / --
Leptosia nina / Lepidoptera / -- / -- / -- / -- / FJ392396
Leptopilina australis / Lepidoptera / -- / -- / -- / -- / U28210
Leptopilina clavipes / Lepidoptera / -- / -- / -- / -- / U28211
Lissorhoptrus orzophilus / Coleoptera / -- / GU478331 / -- / GU478329 / GU478334
Laodelphax striatellus / Hemiptera / GU289802 / -- / -- / GU289800 / --
Macrosteles fascifrons / Hemiptera / HQ404764
HQ404770 / -- / -- / HQ404768 / --
Melanitis leda / Lepidoptera / -- / -- / -- / -- / FJ392439
Muscidifurax uniraptor / Hymenoptera / DQ842404 / DQ842293 / DQ842367 / DQ842441 / DQ842329
Nasonia giralti / Hymenoptera / DQ842405 / DQ842294 / DQ842368 / DQ842442 / DQ842330
Nasonia longicornis / Hymenoptera / DQ842406 / FJ390239 / DQ842369 / DQ842443 / DQ842331
Nilaparvata lugens / Hemiptera / GU289772 / GU289771 / GU289774 / GU289770 / --
Nilaparvata miuri / Hemiptera / HQ404752 / GU289807 / -- / HQ404750 / --
Nasonia vitripennis / Hymenoptera / DQ842407
DQ842408 / FJ390240
DQ842297 / DQ842370
DQ842371 / DQ842444
DQ842445 / DQ842332
DQ842333
Ostrinia scapulalis / Lepidoptera / DQ842409 / DQ842298 / DQ842372 / DQ842446 / DQ842334
Otiorhynchus singularis / Coleoptera / GU111703 / -- / -- / -- / --
Orius strigicollis / Heteroptera / -- / -- / AB499745 / -- / --
Papilio demoleus / Lepidoptera / -- / -- / -- / -- / FJ392438
Pityogenes chalcographus / Coleoptera / -- / FJ444858 / -- / -- / --
Protocalliphora sialia / Diptera / DQ842410 / DQ842299 / DQ842373 / DQ842447 / DQ842335
Sitophilus oryzae / Coleoptera / U28197
Spalgis epius / Lepidoptera / -- / -- / -- / EU127711 / --
Sogatella furcifera / Hemiptera / GU289784 / -- / -- / GU289776 / --
Solenopsis invicta / Hymenoptera / DQ842411 / DQ842300 / DQ842374 / DQ842448 / DQ842336
Surendra vivarna / Lepidoptera / -- / -- / EU127817 / -- / --
Tribolium confusum / Coleoptera / DQ842412 / FJ390243 / DQ842375 / DQ842449 / DQ842337
Tetrasthichus coeruleus / Hymenoptera / -- / -- / GU724215 / -- / --
Trichogramma deion / Hymenoptera / DQ842413 / DQ842302 / DQ842376 / DQ842450 / DQ842338
Tirumala limniace / Lepidoptera / -- / -- / -- / -- / FJ392440
Teleogryllus taiwanemma / Orthoptera / -- / DQ842303 / DQ842377 / DQ842451 / DQ842339
Tetranychus urticae / Trombidiformes / HQ404788 / -- / -- / HQ404774
Udaspes folus / Lepidoptera / -- / -- / -- / -- / FJ392397
Drosophila melanogaster wMel / Diptera / DQ842415 / AE017196 / DQ842378 / DQ842452 / DQ842340
Supplementary Figure Legends
Figure S1: Collection localities in Chiapas, Mexico.
Figure S2: Phylogenetic relationships of Wolbachia strains based on the coxA gene. Node support is given by RAxML, MrBayes, GARLI; respectively. Label of strain discovered in this study is in boldface.
Figure S3: Phylogenetic relationships of Wolbachia strains based on the fbpA gene. Node support is given by RAxML, MrBayes, GARLI; respectively. Label of strain discovered in this study is in boldface.
Figure S4: Phylogenetic relationships of Wolbachia strains based on the hcpA gene. Node support is given by RAxML, MrBayes, GARLI; respectively. Label of strain discovered in this study is in boldface.
Figure S5: Phylogenetic relationships of Wolbachia strains based on the fstZ gene. Node support is given by RAxML, MrBayes, GARLI; respectively. Label of strain discovered in this study is in boldface.
Figure S6: Phylogenetic relationships of Wolbachia strains based on the gatB gene. Node support is given by RAxML, MrBayes, GARLI; respectively. Label of strain discovered in this study is in boldface.