The Methylation Assay
Primer sets were designed for amplicon sizes of less than 200 bps using Primer Premier 5.0. Primers were HPLC-purified, and forward primers were 5'-labeled with 6-FAMTM (Sangon Biotech). The primer sequences, expected product sizes and concentrations are listed in Supplementary Table 2. One nanogram of genomic DNA was digested by mixing with 5 U HhaI (NEB, Beijing, China), 1 μl 10× NEB Buffer, 0.1 μl 100× BSA and double-distilled water to a total volume of 10 μl. The mixture was incubated in a GeneAmp PCR system 9700 for 20 min at 37 °C to facilitate restriction digestion, and then 65°C at 20 min to inactivate enzyme. Immediately following digestion, L1-L7 were amplified using a portion of the digested DNA as template. In the multiplex PCR, 5 μl digested DNA was amplified in the presence of 12.5 μl 2× QIAGEN Multiplex PCR Master Mix, 2.5 μl 5× Q-Solution, 0.2-0.3 μM primers and nuclease-free water to a total volume of 25 μl. A GeneAmp PCR system 9700 was used under the following conditions: 95°C for 15 min, 30 cycles of 94°C for 30 s, 59°C for 1 min, 72°C for 45 s, and a final extension step of 72°C for 10 min. Amplified fragments were purified with the MinElute PCR purification kit (QIAGEN), and then separated and detected by capillary electrophoresis. One μl of PCR product was diluted in 12.5 μl Hi-DiTM Formamide (Thermo Fisher) containing 0.5 μl of Orange 500 internal size standard (PeopleSpot) and denatured for 3 min at 95°C followed by snap cooling on ice for 3 min. The following electrophoresis conditions were used for the 3130 Genetic Analyzers: 10 s injection time, 3 kV injection voltage, 15 kV run voltage, 60°C, 30 min run time. Profiles were analyzed using GeneMapper ID 3.2.1 analysis software (Thermo Fisher). A peak detection threshold of 100 relative fluorescence units (RFUs) was used for positive marker identification calls.
HhaI can cleave the DNA at its recognition sequence GCGC if the site is unmethylated, while leaving methylated targets intact. In the electropherogram, the methylated locus produces a strong signal in the electropherogram (see methylated), while unmethylated locus produces a weak signal or no signal (see unmethylated).
Supplementary Table 2 Seven loci used for methylation assay
# / Locusa / Locationa / Forward primer / Reverse primer / Size (bp) / Conc.bL1 / 00021527 / Chr 17: 31160293 / TTCGAAATTGTAGGGAAAGAAAGGCT / GTTAGGAAACGAAAGAGGAGGGACC / 73 / 0.2
L2c / Not applicable / Not applicable / GAGCGACGCCCAGGAAGTC / ATCCCAGTTTAGGAAAAAAATACC / 102 / 0.3
L3 / 00206052 / Chr 10: 103338133 / CTTAGCAGGGGAAAGATGGCG / GAGGGAAAAAAACGAAGGAGCC / 117 / 0.2
L4 / 05646865 / Chr 1: 41259495 / CAGGACTCTGAGGACTGGCTGG / TTCATCAGTGTGCCAAAAAGCG / 147 / 0.2
L5 / 24743310 / Chr 17: 19560497 / GTCCTGGAGGCTGTCCATTCC / GCTCATCCCACAAGTTGCCAT / 170 / 0.3
L6 / 00211661 / Chr 11: 72111267 / GAAGAAGGAGTGTGTGCCCAGAAG / CCGCATAAGGAGACAGAGAGGCTA / 185 / 0.3
L7 / 00176879 / Chr 20: 2791525 / AGACGCATCTCCAGCCCCT / CCGCCTCCTTCGGAAAGTG / 191 / 0.3
a Nomenclature adopted from the description in the 27k Illumina Infinium Methylation Beadchip.
b The concentration refers to both the forward and reverse primers.
c Primer sequences adopted from Wasserstrom et al. [17].