Pd / Pd_AtCag_F3
Pd_AtCag_R4 / CAAAATGTACCACAACAGAATACGCAAGA
ACTGCTGGTACGTGGCTTACAAGACC / 60
ACT / ACT-CAT400-F1
ACT-CAT400-R2 / ATGGCGATTTTATTTACTGTGATTGA
TGAGTAACTATTTCACTTTTATTTATTTTCTTG / 55
Inv 5’ / Inv5_F2
Inv5_R3 / ATGATAAAGATTCAAGATCA
ACTGGAGCCACGTTACCAA / 50
Wg / Wg_rc_1
Wg_rc_2 / TTGCTGGATGCGCTTGCCGAGTTTCCG
CTTGGTYTCGGTYTTGTTRCCGC / 50
Decapentaplegic / Dpp5p2
Dpp3p2 / GCGTACTACTGCCAAGGCGACTGC
TGTTCACTTCGTCCATATACAACATTG / 60
Cubitus interruptus / Ci_rc_F1
Ci_rc_R1 / CCNTTYAARGCNGARTAYATG
CCNGGRTAYTCRCANGTRTANGG / 50
pMOSblue vector / T7
M13 / TAATACGACTCACTATAGGG
TGTAAAACGACGGCCAGT / 53
Supplementary table 1. Primer sequences and annealing temperatures for the AFLP derived markers and candidate genes for which a P. dardanus specific sequence was obtained (excluding engrailed, the primers for which were taken from Kronforst et al, 2005).
AFLP Linkage Group ID / number of AFLPs in Linkage Group / scores for 6 hippocoon daughters / scores for 5 cenea daughers / scores for 10 sons1 / 7 / 111111 / 11111 / 0000000000
2 / 16 / 000001 / 11010 / 0111011000
3 / 15 / 110110 / 01110 / 1001101001
4 / 14 / 000000 / 11111 / 1011000110
5 / 14 / 110001 / 10110 / 1101000011
6 / 13 / 011111 / 11110 / 1011100011
7 / 12 / 111100 / 11010 / 1111111010
8 / 12 / 110011 / 10101 / 1001000101
9 / 12 / 010010 / 11010 / 0100010110
10 / 11 / 000111 / 00111 / 1110101111
11 / 11 / 101011 / 01001 / 0101011111
12 / 10 / 001011 / 11101 / 1110110000
13 / 10 / 111111 / 10101 / 0110010100
14 / 9 / 111010 / 10110 / 1111111011
15 / 9 / 010011 / 11010 / 1001011001
16 / 9 / 101000 / 10101 / 1001101111
17 / 8 / 011100 / 01000 / 0010101001
18 / 8 / 011111 / 10001 / 1011001100
19 / 8 / 001110 / 00010 / 1100110110
20 / 8 / 001011 / 10110 / 1110111101
21 / 7 / 010100 / 00001 / 0001010110
22 / 7 / 101101 / 11111 / 0011011010
23 / 6 / 010110 / 00000 / 1011101010
24 / 6 / 010010 / 01100 / 0001001101
25 / 6 / 001100 / 00000 / 0101110011
26 / 5 / 000010 / 10010 / 0110101101
27 / 5 / 010010 / 00100 / 0101010110
28 / 5 / 110111 / 11100 / 1000011111
29 / 5 / 110010 / 01001 / 0011100010
30 / 4 / 110001 / 00000 / 1111010011
Supplementary table 2. AFLP linkage group segregation patterns in offspring of female-informative Brood 99. Linkage Group 1 corresponds to the sex chromosomes Z/W. The H-locus maps to AFLP Linkage Group 4.
