Supplementarydata
Supplementary Table 1Statistical analysis of the RNA-seq data.
Library / All Raw reads / All Quality filter / All Mapped readsControl / 25,159,818 / 18,893,077 / 15,771,117(83.4%）
Acclimated / 45,807,669 / 35,083,069 / 31,126,895(88.7%)
Acclimated salt stressed / 44,468,233 / 34,177,856 / 30,626,112(89.6%)
Non-acclimated salt stressed / 35,919,903 / 30,680,083 / 27,062,327(88.2%)
Supplementary Table 2 518 DEGs found in SA samplescompared to untreated controls.
Supplementary Table 3 Functional classification of up-regulated genes in SAsamples in comparison withthe non-treated controls.
Supplementary Table 4 DEGs in NASS and SASS samples versus untreated controls and comparison ofthe RNA-seq dataof NASS and SASS samples with previous microarray profiling of 150 mM NaCl-treated Arabidopsis roots (Jiang and Deyholos 2006).Supplementary Table 5 245 DEGs in SASS versus NASS samples.
Supplementary Table 6 The repressed genes enriched for the ethylene signaling pathway, nucleic acid metabolic process, and senescence in SASSsamples compared toNASSsamples.
Supplementary Table 7102 out of 245 DEGs related to biotic stresses in SASS samples compared toNASS samples
Supplementary Table 8Primers used in the verification of the RNA-seq data by qPCR.
Supplementary Fig. 1
Phenotypic analysis of Arabidopsis seedlings after 20 d on 200 mM NaCl with (right panel) or without salt acclimation (left panel). Salt acclimated seedlings were treated with 50 mM NaCl for 48 hours then transferred to 200 mM NaCl medium for 20 d.
Supplementary Fig. 2
RT-PCR analysis of biotic stress markers,RD29A and RD20 in acclimated for 48 h wild type plants treated with 200 mM NaCl for1 h, 3 h, 6 h, 12 h, 24 h, or 48 h.
Primers used for RT-PCR are listed as follows:
RD29AF: TGAAGGAGACGCAACAAGGG
RD29AR: CCAGAATCTTGAACTCCCTTACCT
RD20F: AGAGCATCCGAATGGAACAG
RD20R:CTGGGACATACCTTCCTTCG
ActinF: ATCCTCCGTCTTGACCTTGC
ActinR: AGCGATACCTGAGAACATAGTGG
Supplementary Fig. 3
DEGs found when comparingdifferent salt stress conditions.
A. SA samples versus untreated controls. B. SASS versus NASS samples. C. NASS samples versus untreated controls. D. SASS samples versus untreated controls. E. NASS versus SA samples. F. SASS versus SA samples.Bars were divided to show the numbers of genes whose expression levels changed 2- 4-fold, 4-8-fold, 8-32-fold or over 32-fold.
Supplementary Fig.4
Comparison of DEGs found by microarray profiling of Arabidopsis roots treated with 150 mM NaCl toNASS orSASS samples(Jiang and Deyholos 2006).
A. Number of genes which were up-regulated or down-regulated by 150 mM NaCl in Arabidopsis roots, compared to untreated controls.The number of genesshared between 150 mM NaCl and NASS samples (B) or SASS samples(C).Of the shared genes, the number of genes which behaved similarly in both compared conditions is shown in the right panel of (B) and (C).
Supplementary Fig.5
Heat map showsthe fold change of95 genes under different conditions.
Conditions shown from left to right: SA samples versus untreated control, SASS versus NASSsamples,SASSversus SA samples,orNASSversusSA samples. The color represents the Log2FC calculated by R package edgeR.
Supplementary reference
Jiang Y, Deyholos MK (2006) Comprehensive transcriptional profiling of NaCl-stressed Arabidopsis roots reveals novel classes of responsive genes. BMC Plant Biol 6(1):25. doi:10.1186/1471-2229-6-25