Supplementary Table 1: Genes on the array and their known link to cancer.
12-Plex GenesGene / Gene product / Chromosomal Location / Breast Cancer Related / Breast Cancer Up or Down Regulated / Cancer Related / Regulated Through Cytosine Methylation / Promoter Methylation in Cancer / Possible Link to Cancer / No Known Link to Cancer
UBE1y1 region
Zfy1 / zinc finger protein 1 Y linked / chrY:45018685-45090887 / X
Zfy2 / zinc finger protein 2 Y linked / chrY:45018773-45090660 / X
Eif2s3y / eukaryotic translation initiation factor 2 / chrY:45304090-45322070 / X
Uty / tetratricopeptide repeat protein / chrY:45431798-45580391 / X1, 2
Rbmy1a1
(atlas-NA) / RNA binding motif protein Y chromosome family / chrY:45843592-45854921 / X3, 4
chrY:45875230-45886380
Ddx3y
(atlas-NA) / DEAD (Asp-Glu-Ala-Asp) box polypeptide 3 / chrY:45605401-45630385 / X5
Sry
(atlas-NA) / sex determining region Y / chrY:46053430-46054617 / X6
H2al2y / H2al2y protein / chrY:45996405-45996740 / X
Ube1y1 / ubiquitin-activating enzyme E1 Chr Y1 / chrY:45112191-45137702 / X
Usp9y
(atlas-NA) / ubiquitin specific peptidase 9 Y chromosome / chrY:45633549-46488301 / X7 / ↑7
Jarid1d
(Kdm5d) / jumonji AT rich interactive domain 1D (Rbp2) / chrY:45191266-45237289 / X5
Sphk1 locus
Sphk1 / sphingosine kinase 1 isoform 2 / chr11:116204476-116207797 / X8-11 / ↑11
Sphk1 / sphingosine kinase 1 isoform 1 / chr11:116205869-116207797 / X12
Aanat / arylalkylamine N-acetyltransferase / chr11:116264816-116268673 / X
Ube2o
(atlas-NA) / ubiquitin-conjugating enzyme E2O / chr11:116208882-116252576 / X13
Nhp2l1 region
Sly
(mouse specific) / Sycp3 like Y-linked / chrY:31748632-31774772
Nhp2l1
(atlas-NA) / NHP2 non-histone chromosome protein 2-like 1 / chrY:36993859-37000112 / X14
Ccdc134 / coiled-coil domain containing 134 / chrY:37101572-37115850 / X
Tnfrsf13c
(atlas-NA) / tumor necrosis factor receptor superfamily / chrY:37196842-37200209 / X15-18
Srebf2
(atlas-NA) / sterol regulatory element binding factor 2 / chrY:37120919-37180062 / X19, 20
Cenpm / centromere protein M / chrY:37021942-37032501 / X21
Pseudoautosomal region X/Y
Frmpd4 / FERM and PDZ domain containing 4 / chrX:157583989-158689913 / X
Arhgap6
(atlas-NA) / Rho GTPase activating protein 6 isoforms a and b / chrX:158907779-159417115 / X22, 23
Hccs
(atlas-NA) / holocytochrome c synthetase / chrX:159424215-159432960 / X24
Mid1 / midline 1 / chrX:159797927-160103361 / X
Msl31 / male-specific lethal-3 homolog 1 / chrX:158766798-158786582 / X
Amelx
(atlas-NA) / amelogenin X chromosome isoforms 1 and 2 / chrX:159288794-159299889 / X25, 26
HoxD Domain
Lnp / lunapark isoforms a and b / chr2:74409003-74473114 / X
Evx2 / even skipped homeotic gene 2 homolog / chr2:74549784-74553585 / X
Mtx2 / metaxin2 / chr2:74720017-74772597 / X27
Hoxd1 / homeobox D1 / chr2:74657146-74659307 / X28-30 / X29, 30 / X29, 30
Hoxd12 / homeo box D12 / chr2:74569196-74571871 / X31 / ↑31 / X32 / X32
Hoxd8 / homeobox D8 / Chr2: 74543546 – 74545364 / X31 / ↓31
Hoxd4 / homeobox D4 / Chr2: 74560035 – 74567216 / X31, 33 / ↓31, 33
Hoxd13 / homeobox D13 / Chr2: 74506367 - 74509655 / X31, 34 / ↑31, 34 / X32 / X32
Hoxd11 / homeobox D11 / Chr 2: 74520450 – 74522195 / X35 / ↓35 / X32 / X32, 35
Hoxd3 / homeobox D3 / Chr2: 74550050 – 74586328 / X31 / ↓31 / X30, 36
Hoxd9 / homeobox D9 / Chr2: 74535820 – 74538265 / X31 / ↓31
Hoxd10 / homeobox D10 / Chr2: 74530028 – 74533160 / X37 / ↓31, 38↑37
Gata2 locus
Gata2 / GATA binding protein 2 / chr6:88533242-88541604 / X39-41
Dnajb8 / DNAJ homolog subfamily B member 8 / chr6:88556719-88557749 / X
Pou5f1 locus
H2-Q10 / histocompatibility 2 Q region locus 10 / chr17:33979121-33983597 / X
Pou5f1 / POU domain class 5 transcription factor 1 / chr17:34015506-34020681 / X42 / ↑42
Psors1c2 / MHC psoriasis candidate / chr17:34043267-34044643 / X
Cdsn / corneodesmosin / chr17:34062110-34067317 / X
H2-T23 / histocompatibility 2 T region locus 23 / chr17:34070737-34612336 / X
Tcf19 / transcription factor 19 / chr17:34022682-34026702 / X
Cchcr1 / coiled-coil alpha-helical rod protein 1 / chr17:34027064-34041215 / X43 / ↑43
HoxA Domain
Skap2 / src family associated phosphoprotein 2 / chr6:51806117-51959670 / X44
Hoxa13 / homeo box A13 / chr6:52206557-52208253 / X45
Evx1 / even skipped homeotic gene 1 homolog / chr6:52261101-52265983 / X46
Hibadh / 3-hydroxyisobutyrate dehydrogenase precursor / chr6:52493840-52588209 / X
Jazf1 / expressed sequence AI591476 (may not be in region) / chr6:52718270-52843545 / X47
Tax1bp1 / Tax1 binding protein 1 homolog / chr6:52663222-52715957 / X48
Hoxa9 / homeobox protein A9 / Chr6: 52174053 – 52177369 / X49 / ↓49 / X49 / X49
Hoxa6 / homeobox A6 / Chr6: 52156364 – 52158623 / X50 / X50 / X50
Hoxa2 / homeobox A2 / Chr6: 52112510 – 52114830 / X51
Hoxa7 / homeobox A7 / Chr6: 52165623 – 52168572 / X52 / X53 / X54
Hoxa11 / homeobox A11 / Chr6: 52192105 – 52195766 / X55 / X55
Hoxa4 / homeobox A4 / Chr6: 52139686 – 52141702 / X56 / X50
Hoxa1 / homeobox A1 / Chr6: 52105366 - 52108316 / X57 / ↑57 / X58
Hoxa5 / homeobox A5 / Chr6: 52151753 – 52154586 / X59 / ↓59 / X60 / X60
Hoxa3 / homeobox A3 / Chr6: 52119061 – 52150937 / X61
Hoxa10 / homeobox A10 / Chr6: 52181196 – 52184938 / X62
H19 imprinting transition region
Syt8 / synaptotagmin VIII / chr7:130139749-130145170 / X
Lsp1 / lymphocyte specific 1 / chr7:130176615-130199371 / X63
Mrpl23 / mitochondrial ribosomal protein L23 / chr7:130237889-130245514 / X64
Tnnt3 / troponin T3 skeletal fast / chr7:130203615-130220775 / X
Tnni2 / troponin I skeletal fast 2 / chr7:130147240-130149177 / X
REFERENCES CITED
1.Sethi, S., Benninger, M.S., Lu, M., Havard, S. & Worsham, M.J. Noninvasive molecular detection of head and neck squamous cell carcinoma: an exploratory analysis. Diagn Mol Pathol18, 81-7 (2009).
2.Dasari, V.K. et al. Expression analysis of Y chromosome genes in human prostate cancer. J Urol165, 1335-41 (2001).
3.Tsuei, D.J., Chang, M.H., Chen, P.J., Hsu, T.Y. & Ni, Y.H. Characterization of integration patterns and flanking cellular sequences of hepatitis B virus in childhood hepatocellular carcinomas. J Med Virol68, 513-21 (2002).
4.Tsuei, D.J. et al. RBMY, a male germ cell-specific RNA-binding protein, activated in human liver cancers and transforms rodent fibroblasts. Oncogene23, 5815-22 (2004).
5.Tabernero, M.D. et al. Patient gender is associated with distinct patterns of chromosomal abnormalities and sex chromosome linked gene-expression profiles in meningiomas. Oncologist12, 1225-36 (2007).
6.Bianco, B., Lipay, M., Guedes, A., Oliveira, K. & Verreschi, I.T. SRY gene increases the risk of developing gonadoblastoma and/or nontumoral gonadal lesions in Turner syndrome. Int J Gynecol Pathol28, 197-202 (2009).
7.Deng, S. et al. Over-expression of genes and proteins of ubiquitin specific peptidases (USPs) and proteasome subunits (PSs) in breast cancer tissue observed by the methods of RFDD-PCR and proteomics. Breast Cancer Res Treat104, 21-30 (2007).
8.Nava, V.E., Hobson, J.P., Murthy, S., Milstien, S. & Spiegel, S. Sphingosine kinase type 1 promotes estrogen-dependent tumorigenesis of breast cancer MCF-7 cells. Exp Cell Res281, 115-27 (2002).
9.Sarkar, S. et al. Sphingosine kinase 1 is required for migration, proliferation and survival of MCF-7 human breast cancer cells. FEBS Lett579, 5313-7 (2005).
10.Sukocheva, O., Wang, L., Verrier, E., Vadas, M.A. & Xia, P. Restoring endocrine response in breast cancer cells by inhibition of the sphingosine kinase-1 signaling pathway. Endocrinology150, 4484-92 (2009).
11.Ruckhaberle, E. et al. Microarray analysis of altered sphingolipid metabolism reveals prognostic significance of sphingosine kinase 1 in breast cancer. Breast Cancer Res Treat112, 41-52 (2008).
12.Imamura, T., Miyauchi-Senda, N., Tanaka, S. & Shiota, K. Identification of genetic and epigenetic similarities of SPHK1/Sphk1 in mammals. J Vet Med Sci66, 1387-93 (2004).
13.Dessen P., L.M.S. in Atlas of Genetics and Cytogenetics in Oncology and Haematology (2002).
14.Dessen P., L.M.S. in Atlas of Genetics and Cytogenetics in Oncology and Haematology (2002).
15.Kohno, T. et al. Aberrant expression of BAFF receptor, a member of the tumor necrosis factor receptor family, in malignant cells of nonhematopoietic origins. Genes Cells13, 1061-73 (2008).
16.Paterson, J.C. et al. The differential expression of LCK and BAFF-receptor and their role in apoptosis in human lymphomas. Haematologica91, 772-80 (2006).
17.Rodig, S.J., Shahsafaei, A., Li, B., Mackay, C.R. & Dorfman, D.M. BAFF-R, the major B cell-activating factor receptor, is expressed on most mature B cells and B-cell lymphoproliferative disorders. Hum Pathol36, 1113-9 (2005).
18.Novak, A.J. et al. Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood103, 689-94 (2004).
19.Chen, Y. & Hughes-Fulford, M. Human prostate cancer cells lack feedback regulation of low-density lipoprotein receptor and its regulator, SREBP2. Int J Cancer91, 41-5 (2001).
20.Ettinger, S.L. et al. Dysregulation of sterol response element-binding proteins and downstream effectors in prostate cancer during progression to androgen independence. Cancer Res64, 2212-21 (2004).
21.Brickner, A.G. et al. The PANE1 gene encodes a novel human minor histocompatibility antigen that is selectively expressed in B-lymphoid cells and B-CLL. Blood107, 3779-86 (2006).
22.Katoh, M. Characterization of human ARHGAP10 gene in silico. Int J Oncol25, 1201-6 (2004).
23.Katoh, Y. & Katoh, M. Identification and characterization of ARHGAP27 gene in silico. Int J Mol Med14, 943-7 (2004).
24.Dessen P., L.M.S. in Atlas of Genetics and Cytogenetics in Oncology and Haematology (2002).
25.Abiko, Y. et al. Immunohistochemical localization of amelogenin in human odontogenic tumors, using a polyclonal antibody against bovine amelogenin. Med Electron Microsc34, 185-9 (2001).
26.Gibson, C.W. et al. Transgenic mice that express normal and mutated amelogenins. J Dent Res86, 331-5 (2007).
27.Vey, N. et al. Identification of new classes among acute myelogenous leukaemias with normal karyotype using gene expression profiling. Oncogene23, 9381-91 (2004).
28.Manohar, C.F., Salwen, H.R., Furtado, M.R. & Cohn, S.L. Up-regulation of HOXC6, HOXD1, and HOXD8 homeobox gene expression in human neuroblastoma cells following chemical induction of differentiation. Tumour Biol17, 34-47 (1996).
29.Jacinto, F.V., Ballestar, E., Ropero, S. & Esteller, M. Discovery of epigenetically silenced genes by methylated DNA immunoprecipitation in colon cancer cells. Cancer Res67, 11481-6 (2007).
30.Rauch, T., Li, H., Wu, X. & Pfeifer, G.P. MIRA-assisted microarray analysis, a new technology for the determination of DNA methylation patterns, identifies frequent methylation of homeodomain-containing genes in lung cancer cells. Cancer Res66, 7939-47 (2006).
31.Makiyama, K. et al. Aberrant expression of HOX genes in human invasive breast carcinoma. Oncol Rep13, 673-9 (2005).
32.Furuta, J. et al. Silencing of Peroxiredoxin 2 and aberrant methylation of 33 CpG islands in putative promoter regions in human malignant melanomas. Cancer Res66, 6080-6 (2006).
33.Tan, Y. et al. Transcriptional inhibiton of Hoxd4 expression by miRNA-10a in human breast cancer cells. BMC Mol Biol10, 12 (2009).
34.Cantile, M. et al. HOX D13 expression across 79 tumor tissue types. Int J Cancer125, 1532-41 (2009).
35.Miyamoto, K. et al. Identification of 20 genes aberrantly methylated in human breast cancers. Int J Cancer116, 407-14 (2005).
36.Kron, K. et al. Discovery of novel hypermethylated genes in prostate cancer using genomic CpG island microarrays. PLoS One4, e4830 (2009).
37.Fassan, M. et al. MicroRNA expression profiling of male breast cancer. Breast Cancer Res11, R58 (2009).
38.Carrio, M., Arderiu, G., Myers, C. & Boudreau, N.J. Homeobox D10 induces phenotypic reversion of breast tumor cells in a three-dimensional culture model. Cancer Res65, 7177-85 (2005).
39.Hoene, V. et al. GATA factors in human neuroblastoma: distinctive expression patterns in clinical subtypes. Br J Cancer101, 1481-9 (2009).
40.Yang, Z. et al. Increased c-Jun expression and reduced GATA2 expression promote aberrant monocytic differentiation induced by activating PTPN11 mutants. Mol Cell Biol29, 4376-93 (2009).
41.Zhang, S.J., Shi, J.Y. & Li, J.Y. GATA-2 L359 V mutation is exclusively associated with CML progression but not other hematological malignancies and GATA-2 P250A is a novel single nucleotide polymorphism. Leuk Res33, 1141-3 (2009).
42.Ben-Porath, I. et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet40, 499-507 (2008).
43.Suomela, S. et al. HCR, a candidate gene for psoriasis, is expressed differently in psoriasis and other hyperproliferative skin disorders and is downregulated by interferon-gamma in keratinocytes. J Invest Dermatol121, 1360-4 (2003).
44.Harada, T. et al. Genome-wide DNA copy number analysis in pancreatic cancer using high-density single nucleotide polymorphism arrays. Oncogene27, 1951-60 (2008).
45.Gu, Z.D. et al. HOXA13 promotes cancer cell growth and predicts poor survival of patients with esophageal squamous cell carcinoma. Cancer Res69, 4969-73 (2009).
46.Lui, W.O. et al. CREB3L2-PPARgamma fusion mutation identifies a thyroid signaling pathway regulated by intramembrane proteolysis. Cancer Res68, 7156-64 (2008).
47.Thomas, G. et al. Multiple loci identified in a genome-wide association study of prostate cancer. Nat Genet40, 310-5 (2008).
48.Nagaraja, G.M. & Kandpal, R.P. Chromosome 13q12 encoded Rho GTPase activating protein suppresses growth of breast carcinoma cells, and yeast two-hybrid screen shows its interaction with several proteins. Biochem Biophys Res Commun313, 654-65 (2004).
49.Reynolds, P.A. et al. Tumor suppressor p16INK4A regulates polycomb-mediated DNA hypermethylation in human mammary epithelial cells. J Biol Chem281, 24790-802 (2006).
50.Strathdee, G. et al. Inactivation of HOXA genes by hypermethylation in myeloid and lymphoid malignancy is frequent and associated with poor prognosis. Clin Cancer Res13, 5048-55 (2007).
51.Rossi Degl'Innocenti, D. et al. Quantitative expression of the homeobox and integrin genes in human gastric carcinoma. Int J Mol Med20, 621-9 (2007).
52.Ota, T., Gilks, C.B., Longacre, T., Leung, P.C. & Auersperg, N. HOXA7 in epithelial ovarian cancer: interrelationships between differentiation and clinical features. Reprod Sci14, 605-14 (2007).
53.Wu, X. et al. Cooperation between EZH2, NSPc1-mediated histone H2A ubiquitination and Dnmt1 in HOX gene silencing. Nucleic Acids Res36, 3590-9 (2008).
54.Rauch, T. et al. Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay. Proc Natl Acad Sci U S A104, 5527-32 (2007).
55.Martinez, R. et al. A microarray-based DNA methylation study of glioblastoma multiforme. Epigenetics4, 255-64 (2009).
56.Klausen, C., Leung, P.C. & Auersperg, N. Cell motility and spreading are suppressed by HOXA4 in ovarian cancer cells: possible involvement of beta1 integrin. Mol Cancer Res7, 1425-37 (2009).
57.Mohankumar, K.M. et al. HOXA1-stimulated oncogenicity is mediated by selective upregulation of components of the p44/42 MAP kinase pathway in human mammary carcinoma cells. Oncogene26, 3998-4008 (2007).
58.Tsou, J.A. et al. Identification of a panel of sensitive and specific DNA methylation markers for lung adenocarcinoma. Mol Cancer6, 70 (2007).
59.Henderson, G.S., van Diest, P.J., Burger, H., Russo, J. & Raman, V. Expression pattern of a homeotic gene, HOXA5, in normal breast and in breast tumors. Cell Oncol28, 305-13 (2006).
60.Watson, R.E., Curtin, G.M., Hellmann, G.M., Doolittle, D.J. & Goodman, J.I. Increased DNA methylation in the HoxA5 promoter region correlates with decreased expression of the gene during tumor promotion. Mol Carcinog41, 54-66 (2004).
61.Drabkin, H.A. et al. Quantitative HOX expression in chromosomally defined subsets of acute myelogenous leukemia. Leukemia16, 186-95 (2002).
62.Chu, M.C., Selam, F.B. & Taylor, H.S. HOXA10 regulates p53 expression and matrigel invasion in human breast cancer cells. Cancer Biol Ther3, 568-72 (2004).
63.Antoniou, A.C. et al. Common variants in LSP1, 2q35 and 8q24 and breast cancer risk for BRCA1 and BRCA2 mutation carriers. Hum Mol Genet18, 4442-56 (2009).
64.Meng, L., Lin, T. & Tsai, R.Y. Nucleoplasmic mobilization of nucleostemin stabilizes MDM2 and promotes G2-M progression and cell survival. J Cell Sci121, 4037-46 (2008).
Supplementary Table 2: Primers for MassArray and qRT-PCR.
Gene/Primer Number / MassARRAY Primers / qRT-PCR Primers
Forward Primer / # NT / Reverse Primer / # NT / Fragment Length / Forward Primer / # NT / Reverse Primer / # NT / Fragment Length
Gata2/1 / AGTTTGTGGGTAGGTTAGGTTGTTG / 25 / AAACAAATAATTTCCCTCTTTTCTCCC / 27 / 335 / CAGAACCGGCCGCTCATCAA / 20 / TTCCGGCGCCATAAGGTGGT / 20 / 107
Gata2/2 / GGGAGAAAAGAGGGAAATTATTTGTTT / 27 / ATACTCCAAAACCATCAAAAACCCA / 25 / 520
Gata2/3 / TTATGGGTTAAAGGTTGGGAGAAGT / 25 / AATCCAAAAAAAATAAAAAACCCTC / 25 / 542
Gata2/4 / TTTTGATGGTTTTGGAGTATAGAGG / 25 / TTCCAAAAAAATCCCAAATTAATCC / 25 / 525
Gata2/5 / TTTTGAATTGATGGGTGTTTTTAGG / 25 / AAAACTAAATTCTAAAATCCAAACCCTATT / 30 / 411
Gata2/6 / GGGTATGGAAGTTTTTTTATGTTTAAGT / 28 / ATCCCTCCTTACCAACAACTATACTTTACT / 30 / 539
huGata2 / GGGGTAGTGCAGCCCGAGGA / 20 / GCGCAGGGGACTGCCACTTT / 20
Hoxa7/1 / TTTTGGAGGATATTTGGGTGAATTTT / 26 / TTCCCATCCTAATCCACCATAAAATAA / 27 / 443 / GCGCAGTTCAGGACCCGACA / 20 / CCGCGTCAGGTAGCGGTTGA / 20 / 103
Hoxa7/2 / TTTTTTGTGGTTAGATAGTTTTTAATGTTT / 30 / ACCAACAACCTCCCTTACCCTTAAC / 25 / 377
Hoxa7/3 / TTGTTATAAATTGGAATTATGTGGTT / 26 / AACACCCAAATCCTAAAATTACCTCTC / 27 / 472
huHoxa7 / TTTAGAATGGAAGGGTAAGAGGTTTAAATA / 30 / ACTAAATCCTACCCACAAAACCACC / 25 / 328 / CAAAGGCGCCTGCGACAAGA / 20 / GCCCCGCTTCCTGTCAGGTC / 20
Gapdh / CCCCCAATGTGTCCGTCGTG / 20 / TGGGCCCTCAGATGCCTGCT / 20 / 98
huGapdh / CCACATCGCTCAGACACCAT / 20 / CCAGGCGCCCAATACG / 16
Supplementary Table 3: Fine mapping of MassArray primers for validation and high-resolution studies.
Gene / Gata2 / Hoxa7Chromosomal Location / chr6:88533242-88541604 / chr6:52162505-52165452
Transcription Start Site / chr6: 88533505 / chr6: 52164283
Strand / + / -
Distance from Transcription Start Site / Primer Set 1 / HpaII Site 1 / -2849 / -2784 / -1739 / -1429
HpaII Site 2 / -2686 / -1706
HpaII Site 3 / -2615 / -
HpaII Site 4 / - / -
HpaII Site 5 / - / -
HpaII Site 6 / - / -
HpaII Site 7 / - / -
Primer Set 2 / HpaII Sites 1 / -2541 / -2515 / -2872 / -2759
HpaII Sites 2 / -2352 / -2770
HpaII Sites 3 / - / -
HpaII Site 4 / - / -
HpaII Site 5 / - / -
Primer Set 3 / HpaII Sites 1 / -2254 / -1950 / -1065 / -763
HpaII Sites 2 / -1927 / -1006
HpaII Sites 3 / - / -
Primer Set 4 / HpaII Site 1 / -2041 / -1950 / - / -
HpaII Site 2 / -1927 / -
HpaII Site 3 / -1669 / -
HpaII Site 4 / -1646 / -
HpaII Site 5 / -1641 / -
Primer Set 5 / HpaII Site 1 / -3951 / -3811 / - / -
HpaII Site 2 / -3585 / -
HpaII Site 3 / - / -
Primer Set 6 / HpaII Site 1 / -4707 / -4548 / - / -
HpaII Site 2 / -4278 / -
Supplementary Table 4:
Detailed list of loci differentially methylated between the primary tumors and the lung metastasis.
HOXA7 / GATA2MG_1 / 1.8415 / 1.6036
MG_2 / 1.4182 / 1.5132
MG_3 / 1.8789 / 1.7226
MG_AVERAGE / 1.7129 / 1.6131
MG_SD / 0.2559 / 0.1050
MG_95%CONFIDENCE / 0.2895 / 0.1188
PT1_1 / -1.2343 / 0.5893
PT1_2 / -1.2155 / 0.5599
PT1_3 / -1.4848 / 0.4304
PT1_AVERAGE / -1.3115 / 0.5265
PT1_SD / 0.1503 / 0.0846
PT1_95%CONFIDENCE / 0.1701 / 0.0957
LM1_1 / -3.0100 / -1.5425
LM1_2 / -2.9734 / -1.4277
LM1_3 / -3.1028 / -2.1497
LM1_AVERAGE / -3.0287 / -1.7066
LM1_SD / 0.0667 / 0.3879
LM1_95%CONFIDENCE / 0.0755 / 0.4390
PT2_1 / -2.3682 / 0.5837
PT2_2 / -2.5719 / 0.4963
PT2_3 / -2.3955 / 0.6993
PT2_AVERAGE / -2.4452 / 0.5931
PT2_SD / 0.1106 / 0.1018
PT2_95%CONFIDENCE / 0.1251 / 0.1152
LM2_1 / -2.2583 / 0.3046
LM2_2 / -2.3381 / 0.1844
LM2_3 / -2.1422 / 0.6174
LM2_AVERAGE / -2.2462 / 0.3688
LM2_SD / 0.0985 / 0.2236
LM2_95%CONFIDENCE / 0.1115 / 0.2530