Supplemental Tables and Figure:
Vector/pAAV backbone / Regulatory Cassette / 5’UTR / Gene(s) / P2A / 3’UTR / Poly-AAAV-RR1 (rat)/ pARAP4 / cTnT (455 bp) / NA / Rrm1 (2378 bp, NM_001013236.1) / NA / NA / SV40
AAV-RR2 (rat)/ pARAP4 / cTnT (455 bp) / NA / Rrm2 (1172 bp, NM_001025740.1) / NA / NA / SV40
AAV-RR1 (human) /Stratagene pAAV / cTnT (455 bp) / cttgcccagactcaacatggcggctacacgtcgcctgtcagtctgtgaagcctaccccgggcgtgggccgcagcgtcgagtaacgtcattcgaaccccgtcgcgcccctttgtgcgtcacgggtggcgggcgcgggaaggggatttggattgttgcgcctctgctctgaagaaagtgctgtctggctccaactccagttctttcccctgagcagcgcctggaacctaacccttcccactctgtcaccttctcgatcccgccggcgctttagagccgcagtccagtcttggatccttcagagcctca / RRM1 (2379 bp, NM_001033.3)2) / NA / ggaaagacttggaagagaccagcatgtcttcagtagccaaactacttcttgagcatagataggtatagtgggtttgcttgaggtggtaaggctttgctggaccctgttgcaggcaaaaggagtaattgatttaaagtactgttaatgatgataatgattttttttttaaactcatatattgggattttcaccaaaataatgcttttgaaaaaaagaaaaaaaaaacggatatattgagaatcaaagtagaagttttaggaatgcaaaataagtcatcttgcatacagggagtggttaagtaaggtttcatcacccctttagcactgcttttctgaagacttcagttttgttaaggagatttagttttactgctttgactggtgggtctctagaagcaaaactgagtgataactcatgagaagtactgataggacctttatctggatatggtcctataggttattctga / Rabbit Beta- Globin
AAV-RR2(human)/
Stratagene pAAV / cTnT (455 bp) / cccgtgcaccctgtcccagccgtcctgtcctggctgctcgctctgcttcgctgcgcctccact / RRM2 (1170 bp, NM_001034.3) 2) / NA / aactgaagatgtgcccttacttggctgattttttttttccatctcataagaaaaatcagctgaagtgttaccaactagccacaccatgaattgtccgtaatgttcattaacagcatctttaaaactgtgtagctacctcacaaccagtcctgtctgtttatagtgctggtagtatcaccttttgccagaaggcctggctggctgtgacttaccatagcagtgacaatggcagtcttggctttaaagtgaggggtgaccctttagtgagcttagcacagcgggattaaacagtcctttaaccagcacagccagttaaaagatgcagcctcactgcttcaacgcagattttaatgtttacttaaatataaacctggcactttacaaaca / Rabbit Beta- Globin
AAV-RR1.2 (human)/
Stratagene pAAV / cTnT (455 bp) / ctgagcagcgcctggaacctaacccttcccactctgtcaccttctcgatcccgccggcgctttagagccgcagtccagtcttggatccttcagagcctca / RRM1.RRM2 / ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct1) / aactgaagatgtgcccttacttggctgattttttttttccatctcataagaaaaatcagctgaagtgttaccaactagccacaccatgaattgtccgtaa / Rabbit Beta-Globin
AAV-RR2.1 (human)/
Stratagene pAAV / cTnT (455 bp) / cccgtgcaccctgtcccagccgtcctgtcctggctgctcgctctgcttcgctgcgcctccact / RRM2.RRM1 / ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct1) / ggaaagacttggaagagaccagcatgtcttcagtagccaaactacttcttgagcatagataggtatagtgggtttgcttgaggtggtaaggctttgctgg / Rabbit Beta-Globin
Table S1: Single and dual tandem R1 and R2 cDNA constructs of recombinant AAV vectors.
Control / 1.5x1013 / 4.5x1013 / 1.35x1014IVS;d (mm) / 0.68 ± 0.06 / 0.73 ± 0.06 / 0.72 ± 0.04 / 0.64 ± 0.04
IVS;s (mm) / 0.95 ± 0.03 / 1.12 ± 0.10 / 1.15 ± 0.07 / 1.14 ± 0.04
LVPW;d (mm) / 0.70 ± 0.07 / 0.80 ± 0.04 / 0.82 ± 0.06 / 0.76 ± 0.04
LVPW;s (mm) / 1.10 ± 0.07 / 1.13 ± 0.05 / 1.13 ± 0.05 / 1.10 ± 0.06
LVID;d (mm) / 3.95 ± 0.19 / 3.95 ± 0.13 / 3.58 ± 0.17 / 3.48 ± 0.15
LVID;s (mm) / 2.78 ± 0.13 / 2.55 ± 0.12 / 2.22 ± 0.11 * / 2.08 ± 0.12 *
EF (%) / 63.03 ± 1.22 / 71.55 ± 1.81 / 73.83 ± 2.96 * / 77.58 ± 1.47 *
FS (%) / 29.25 ± 0.85 / 35.48 ± 1.45 / 37.58 ± 2.58 * / 40.44 ± 1.33 *
HR (bpm) / 362.8 ± 51.8 / 378.3 ± 31.6 / 369.7 ± 4.76 / 390.2 ± 23.62
Table S2: In-vivo echocardiography data from mice treated with graded vector doses containing equal concentrations of AAV6-rat R1cTnt455 and AAV6-rat R1cTnt455. Normal 3-5 month old mice were injected with saline (control) or 3 doses (1.5x1013, 4.5x1013 and 1.35x1014 vg/kg of each vector) of rAAV6 vectors containing rat R1 and R2 cDNA driven by cTnT455 and assayed 4 weeks after treatment. IVS;d, intraventricular septum in diastole; IVS;s, intraventricular septum in systole; LVPW;d, left ventricular posterior wall thickness in diastole; LVPW;ds, left ventricular posterior wall thickness in systole; LVID;d, left ventricular internal dimension in diastole; LVID;s, left ventricular internal dimension in systole; EF, ejection fraction; FS, fractional shortening; HR, heart rate. Values are means ± SEM. * P < 0.05 vs control (n = 4 – 6 mice in each group).
Control / rAAV6BW (g) / 29.8 ± 2.1 / 28.1 ± 2.1
HW (mg) / 115.3 ± 11.2 / 121.0 ± 15.2
HW/BW (mg/g) / 3.9 ± 0.4 / 4.3 ± 0.4
Table S3. Heart weight and body weight measurements of control and rAAV6 R1-R2 treated mice. Body weight (BW), heart weight (HW) and HW/BW ratio from 3-5 month old control mice and mice injected with an equal mixture of AAV6-Rrm1cTnT455 and AAV6-Rrm2cTnT455 vectors (7x1013 vg/kg each). Data are mean ± SD (Control n = 7, rAAV6 vector n = 6). No values were significantly different between groups, p > 0.05.
Supplemental Figure Legends:
Figure S1. Plasmid map for rAAV production enabling cardiac specific overexpression of human R1R2. The figure displays the design of the AAV plasmid used for the generation of rAAV vectors in combination via co-transfection with AAV serotype-6 containing capsid. Included within our vector design are the AAV2 inverted terminal repeats (ITR), the novel cardiac specific promoter (cTnT455), 100-bp of untranslated region (UTR) for the corresponding RRM cDNA, the P2A signal enabling co-delivery and expression of both RRM-subunits to the same cardiomyocytes, the rabbit beta-globin poly-adenylation (pA) signal, the ampicillin resistance gene (Ampr) and the ColE1 origin required for plasmid production.
Figure S2. Rrm1 and Rrm2 protein expression in hearts from mice treated with human vectors.
Western blots show overexpression of both Rrm1 and Rrm2 subunits in mice 4 weeks after injection of the human cDNAs RRM1.RRM2 (R1.2), RRM2.RRM1 (R2.1), or RRM1 and RRM2 (R1 + R2) at 7x1013 vg/kg for each vector.
Figure S3: Ejection fraction of mice treated with human vectors.
Ejection fraction (EF) assessed by echocardiography in mice 4 weeks after injection of the human cDNAs RRM1.RRM2 (R1.2), RRM2.RRM1 (R2.1), or RRM1 and RRM2 (R1 + R2) at 7x1013 vg/kg for each vector. * P <0.05 vs. control (CON), n=3-4.
