SUPPLEMENTAL DATA
Supplemental Table 1. aCGH array descriptions
Parameter / CMA Version 6 Oligo / CMA Version 7 Oligo / CMA Version 8 OligoTotal probes (60 mers) / ~44,000 Oligos / ~105,000 Oligos / ~180,000 Oligos
Targeted genomic disorders / >140 / 420 genes and an additional 61 genomic regions with known disease association. / >1700 genes
Subtelomes/pericentric regions covered / 41/43 / 41/43 / 41/43
Backbone coverage / 1 Clone per band / ~30 kb / ~30 kb
Low copy repeat regions with additional coverage / N/A / 290 / 290
Probes in the 15q25.2 region / 22 / 136 / 152
Parameter / Agilent Human Gemome CGH 244K Oligo (G4411B) / Agilent Human Gemome CGH 1M Oligo (G4447A)
Total probes (60 mer) / 243,504 / 974,016
Median probe spacing across the genome / 6.4kb / 3.12kb
Probes in the 15q25.2 region / 278 / 985
Supplemental Table 2. Primers used in quantitative real-time PCR analysis
Gene Detected / Primer Sequence / Region Amplified15q Forward / 5' – AATCTTTTCACTTTGGGAAGACTGG – 3’ / 153 bp region of exon 5 of BNC1
15q Reverse / 5' – AAAAAGCCAACAACCTGTTACCAAT - 3’
RPS17 Forward / 5’- TGGAAGCCAAGAACCCATAG - 3’ / 232 bp region of RPS17 with primers located in introns flanking exon 3
RPS17 Reverse / 5’- CCAGGTGGGAGTTGATTTGT - 3’
Supplemental Table 3. Results of standardized testing of Patient 1
Test / Result / Age at evaluationStanford-Binet Intelligence Scale (4th edition) / Standard Age Scores:
Verbal Reasoning 63
Abstract Visual Reasoning 52
Quantitative Reasoning 64
Short Term Memory SAS 68
Test Composite 54 / 5 years
Differential Ability Scales / Results of subtests:
Matrices 16th percentile,
Pattern Construction 3rd percentile,
Similarities 8th percentile,
Naming Vocabulary (age equivalent of 6 yr, 10 mo),
Verbal Comprehension (age equivalent of 5 yr, 7 mo) / 10 years, 5 months
Supplemental Table 4. Clinical and molecular description of patient with 15q25.2 duplications
Patient ID / Indication / Minimal Duplication (hg19) / Maximal Duplication(hg19) / Additional Chromosomal
Anomaly / Inheritance
15q25 Duplication
Patient 4 / Hypertension
Obesity
Developmental delay / 83,310,620-84,706,999
(~1.4 Mb) / 82,566,687-85,119,172
(~2.5 Mb) / Deletion 22q11.21, velocardiofacial/ DiGeorge Syndrome / Unknown
Patient 5 / Atrial septal defect
Cataracts (also present in mother)
Blue sclerae
Short neck/redundant skin Shawl scrotum
Joint hypermobility / 83,221,339-85,650,064
(~2.4 Mb) / 82,566,687-85,893,586
(~3.3 Mb) / None / Inherited (Paternal)
Supplemental Table 5. Candidate genes of possible clinical relevance within 15q25.2 deletion interval
ADAMTSL3 / 609199 / SNP rs10906982 in ADAMTSL3 is associated with adult height. The function of ADAMTSL3 unknown but it is speculated to be involved in cell-cell or cell-extracellular matrix adhesion or regulation of ADAMTS protease functions. / [1,2]*
AP3B2 / 602166 / AP3B2 is part of a neuron-specific heterotetrameric vesicle-coat protein complex thought to play an important role in neurotransmitter release. / [3, 4]
BNC1 / 601930 / Basonuclin performs a transcriptional regulatory function in growth or suppression of differentiation of keratinocytes. / [5, 6]
BTBD1 / 608530 / BTBD1 is required for muscle cell growth and differentiation in vitro; interacts with Topoisomerase I, a determining factor for DNA replication, recombination and repair, chromatin condensation, and RNA transcription. TopoI protein expression is negatively correlated with BTBD1 expression suggesting TopoI may be targeted for degradation by BTBD1 during myogenesis. High expression in heart and skeletal muscle and upregulated in myogenesis. / [7-9]
CPEB1 / 607342 / Cpeb1-/- mice have abnormal long-term potentiation (LTP) and long-term depression (LTD) demonstrating its role in synaptic plasticity. Cpeb1-/- mice also showed impaired ability to extinguish hippocampal-dependent memories. / [10-12]
HDGFRP3 / -- / Strongly expressed in the developing nervous system; modulates neuronal cytoskeleton and is necessary for proper neurite outgrowth in primary cortical neurons. / [13, 14]
HOMER2 / 604799 / Studies of Homer2-/- mice revealed an important role for this protein in modulating responses to addictive substances including alcohol and cocaine. HOMER2 is a scaffolding protein that plays an important role in maintaining plasticity at glutamatergic synapses. / [15-17]
RPS17 / 180472 / Mutations in RPS17 have been seen in patients with Diamond-Blackfan anemia. RPS17 encodes ribosomal protein of the short ribosomal subunit. / [18, 19]
SH3GL3 / 603362 / Ubiquitously expressed during embryogenesis. Knockdown of sh3gl3 in zebrafish embryos results in vascularization abnormalities. SNP rs2562784 located inside SH3GL3 is associated with adult height. / [20, 21]
* = References in table cited under Supplemental References below.
References for Supplemental Table 5
1. Porter S, Clark IM, Kevorkian L, Edwards DR. The ADAMTS metalloproteinases. Biochem J 2005;386:15-27.
2. Weedon MN, Lango H, Lindgren CM, Wallace C, Evans DM, Mangino M, Freathy RM, Perry JR, Stevens S, Hall AS, Samani NJ, Shields B, Prokopenko I, Farrall M, Dominiczak A; Diabetes Genetics Initiative; Wellcome Trust Case Control Consortium, Johnson T, Bergmann S, Beckmann JS, Vollenweider P, Waterworth DM, Mooser V, Palmer CN, Morris AD, Ouwehand WH; Cambridge GEM Consortium, Zhao JH, Li S, Loos RJ, Barroso I, Deloukas P, Sandhu MS, Wheeler E, Soranzo N, Inouye M, Wareham NJ, Caulfield M, Munroe PB, Hattersley AT, McCarthy MI, Frayling TM. Genome-wide association analysis identifies 20 loci that influence adult height. Nat Genet 2008;40:575-583.
3. Grabner CP, Price SD, Lysakowski A, Cahill AL, Fox AP. (2006). Regulation of large dense-core vesicle volume and neurotransmitter content mediated by adaptor protein 3. Proc Natl Acad Sci USA 2006;103:10035-10040.
4. Fletcher CF, Okano HJ, Gilbert DJ, Yang Y, Yang C, Copeland NG, Jenkins NA, Darnell RB. Mouse chromosomal locations of nine genes encoding homologs of human paraneoplastic neurologic disorder antigens. Genomics 1997;45:313-319.
5. Tseng H, Green H. Basonuclin: a keratinocyte protein with multiple paired zinc fingers. Proc Natl Acad Sci USA 1992;89:10311-1035.
6. Tseng H, Green H. Association of basonuclin with ability of keratinocytes to multiply and with absence of terminal differentiation. J Cell Biol 1994;126:495-506.
7. Pisani DF, Cabane C, Derijard B, Dechesne CA. The topoisomerase 1-interacting protein BTBD1 is essential for muscle cell differentiation. Cell Death Differ 2004;11:1157-1165.
8. Pisani DF, Coldefy AS, Elabd C, Cabane C, Salles J, Le Cunff M, Derijard B, Amri EZ, Dani C, Leger JJ, Dechesne CA. Involvement of BTBD1 in mesenchymal differentiation. Exp. Cell Res 2007;313:2417-2426.
9. Xu L, Yang L, Hashimoto K, Anderson M, Kohlhagen G, Pommier Y, D'Arpa P. Characterization of BTBD1 and BTBD2, two similar BTB-domain-containing Kelch-like proteins that interact with Topoisomerase I. BMC Genomics 2002;3:1.
10. Alarcon JM, Hodgman R, Theis M, Huang YS, Kandel ER, Richter JD. Selective modulation of some forms of schaffer collateral-CA1 synaptic plasticity in mice with a disruption of the CPEB-1 gene. Learn Mem 2004;11:318-327.
11. Berger-Sweeney J, Zearfoss NR, Richter JD. Reduced extinction of hippocampal-dependent memories in CPEB knockout mice. Learn Mem 2006;13:4-7.
12. Burns DM, Richter JD. CPEB regulation of human cellular senescence, energy metabolism, and p53 mRNA translation. Genes Dev 2008;22:3449-3460.
13. Abouzied MM, Baader SL, Dietz F, Kappler J, Gieselmann V, Franken S. Expression patterns and different subcellular localization of the growth factors HDGF (hepatoma-derived growth factor) and HRP-3 (HDGF-related protein-3) suggest functions in addition to their mitogenic activity. Biochem J 2004;378:169-176.
14. El-Tahir HM, Abouzied MM, Gallitzendoerfer R, Gieselmann V, Franken S. Hepatoma-derived growth factor-related protein-3 interacts with microtubules and promotes neurite outgrowth in mouse cortical neurons. J BiolChem 2009;284:11637-11651.
15. Szumlinski KK, Ary AW, Lominac KD, Klugmann M, Kippin TE (2008). Accumbens Homer2 overexpression facilitates alcohol-induced neuroplasticity in C57BL/6J mice. Neuropsychopharmacology 2008;33:1365-1378.
16. Szumlinski KK, Dehoff MH, Kang SH, Frys KA, Lominac KD, Klugmann M, Rohrer J, Griffin W 3rd, Toda S, Champtiaux NP, Berry T, Tu JC, Shealy SE, During MJ, Middaugh LD, Worley PF, Kalivas PW. Homer proteins regulate sensitivity to cocaine. Neuron 2004;43:401-413.
17. Szumlinski KK, Kalivas, PW, Worley PF. Homer proteins: implications for neuropsychiatric disorders. Curr. Opin. Neurobiol., 2006;16:251-257.
18. Cmejla R, Cmejlova J, Handrkova H, Petrak J, Pospisilova D. Ribosomal protein S17 gene (RPS17) is mutated in Diamond-Blackfan anemia. Hum. Mutat. 2007;28:1178-1182.
19. Gazda HT, Sheen MR, Vlachos A, Choesmel V, O'Donohue MF, Schneider H, Darras N, Hasman C, Sieff CA, Newburger PE, Ball SE, Niewiadomska E, Matysiak M, Zaucha JM, Glader B, Niemeyer C, Meerpohl JJ, Atsidaftos E, Lipton JM, Gleizes PE, Beggs AH. Ribosomal protein L5 and L11 mutations are associated with cleft palate and abnormal thumbs in Diamond-Blackfan anemia patients. Am J Hum Genet, 2008:83;769-780.
20. Gomez GA, Veldman MB, Zhao Y, Burgess S, Lin S. Discovery and characterization of novel vascular and hematopoietic genes downstream of etsrp in zebrafish. PLoS One 2009;4:e4994.
21. Lettre G, Jackson AU, Gieger C, Schumacher FR, Berndt SI, Sanna S, Eyheramendy S, Voight BF, Butler JL, Guiducci C, Illig T, Hackett R, Heid IM, Jacobs KB, Lyssenko V, Uda M; Diabetes Genetics Initiative; FUSION; KORA; Prostate, Lung Colorectal and Ovarian Cancer Screening Trial; Nurses' Health Study; SardiNIA, Boehnke M, Chanock SJ, Groop LC, Hu FB, Isomaa B, Kraft P, Peltonen L, Salomaa V, Schlessinger D, Hunter DJ, Hayes RB, Abecasis GR, Wichmann HE, Mohlke KL, Hirschhorn JN. Identification of ten loci associated with height highlights new biological pathways in human growth. Nat Genet 2008;40:584-591.
Supplemental Table 6. 15q25.2 Copy number variants reported in normal controls in the Database of Genomic Variants that include genes located outside low copy repeat clusters.
Loss / 80,451,465..80,838,926 / 1/50 French / RPS17, LOC440295, LOC100133144, LOC80154, LOC100134869 / [1]*
Loss / 80,499,440..80,610,425 / 3/269 HapMap† / LOC440295, RPS17, LOC80154 / [2]
Loss / 80,499,440..80,610,425 / 1/47 Mixed Ethnicity / LOC440295, RPS17, LOC80154 / [3]
Loss / 80676701-81024206/81107580 / 5/270
HapMap† / RPS17, LOC80154, LOC440295, LOC100133144, LOC100134869, CPEB1 / [4]
Loss / 81,080,610..81,250,549 / 1/506 German and 270 HapMap‡ / AP3B2, SCARNA15, FSD2, CPEB1 / [5]
Loss / 81,096,516..81,254,478 / 1/112 HapMap‡ / AP3B2, SCARNA15, FSD2, CPEB1 / [6]
Loss / 81,277,276..81,293,219 / 1/30 HapMap / WHAMM / [7]
Loss / 82,330,480..82,359,162 / 1/270 HapMap / ADAMTSL3 / [4]
Loss / 82,331,742..82,334,554 / 108/270 HapMap / ADAMTSL3 / [8]
Loss / 82,333,799..82,334,729 / 13/30 HapMap / ADAMTSL3 / [7]
Loss / 82,989,843..83,001,758 / 8/2026 / WDR73, NMB / [9]
Loss / 83,063,933..83,217,534 / 1/270 HapMap / ZNF592, ALPK3 / [4]
Loss / 83,253,824..83,255,658 / 3/2026 / SLC28A1 / [9]
Loss / 83,262,944..83,263,311 / 1 Han Chinese / SLC28A1 / [10]
Loss / 83,263,070..83,263,202 / 1 Control / SLC28A1 / [11]
Loss / 83,361,512..83,362,122 / 1/36 Controls / PDE8A / [12]
Loss / 83,451,942..83,685,716 / 1/270 HapMap / PDE8A / [4]
Loss / 83,463,717..83,472,287 / 1/36 Controls / PDE8A / [12]
Gain / 80,509,891..80,849,830 / 5/30 HapMap / RPS17, LOC440295, LOC100133144, LOC80154, LOC100134869 / [7]
Gain / 80676701-81024206/81107580 / 30/270 / RPS17, LOC80154, LOC440295, LOC100133144, LOC100134869, CPEB1 / [4]
Gain / 81,111,888..81,114,643 / 1/50 French / CPEB1 / [1]
Gain / 81,214,819..81,351,633 / 1/47 Mixed Ethnicity / WHAMM, FSD2, HOMER2, SCARNA15 / [3]
Gain / 81,343,492..81,356,434 / 1 Control / HOMER2 / [13]
Gain / 83,213,459..83,263,320 / 2/485 Human Genome Diversity Panel / SLC28A1, ALPK3 / [14]
Gain / 83,213,459..83,263,320 / 2/1064Human Genome Diversity Panel and 790 NINDS / SLC28A1, ALPK3 / [15]
Gain / 83,272,767..83,272,767 / 1/36 Controls / SLC28A1 / [12]
Gain / 83,387,708..83,994,713 / 2/1190 Ontario, Canada / AKAP13, PDE8A / [16]
Gain / 83,451,942..83,685,716 / 10/270 HapMap / PDE8A / [4]
Gain / 83,462,274..83,921,005 / 2/1190 Ontario, Canada / AKAP13, PDE8A / [16]
* = References in table cited under Supplemental References below.
† = It is possible that these losses were identified in an identical patient cohort. Differences in reported breakpoints may be attributed to differences in array analysis or the inability to distinguish between
two nearly identical copies of this region within the genome.
‡ = It is possible that these losses were identified in an identical patient cohort. Differences in reported breakpoints may be attributed to differences in array analysis.
References for Supplemental Table 6
1. de Smith AJ, Tsalenko A, Sampas N, Scheffer A, Yamada NA, Tsang P, Ben-Dor A, Yakhini Z, Ellis RJ, Bruhn L, Laderman S, Froguel P, Blakemore AI. Array CGH analysis of copy number variation identifies 1284 new genes variant in healthy white males: implications for association studies of complex diseases. Hum Mol Genet 2007;16:2783-2794.
2. Locke DP, Sharp AJ, McCarroll SA, McGrath SD, Newman TL, Cheng Z, Schwartz S, Albertson DG, Pinkel D, Altshuler DM, Eichler EE. Linkage disequilibrium and heritability of copy-number polymorphisms within duplicated regions of the human genome. Am J Hum Genet 2006;79:275-290.
3. Sharp AJ, Locke DP, McGrath SD, Cheng Z, Bailey JA, Vallente RU, Pertz LM, Clark RA, Schwartz S, Segraves R, Oseroff VV, Albertson DG, Pinkel D, Eichler EE. Segmental duplications and copy-number variation in the human genome. Am J Hum Genet 2005;77:78-88.
4. Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, González JR, Gratacòs M, Huang J, Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, Mei R, Montgomery L, Nishimura K, Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, Woodwark C, Yang F, Zhang J, Zerjal T, Zhang J, Armengol L, Conrad DF, Estivill X, Tyler-Smith C, Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW, Hurles ME. Global variation in copy number in the human genome. Nature, 2006;444:444-454.
5. Pinto D, Marshall C, Feuk L, Scherer SW. Copy-number variation in control population cohorts. Hum Mol Genet 2007;16 Spec No. 2:R168-73.
6. Wang K, Li M, Hadley D, Liu R, Glessner J, Grant SF, Hakonarson H, Bucan M. PennCNV: an integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome Res 2007;17:1665-1674.
7. Perry GH, Ben-Dor A, Tsalenko A, Sampas N, Rodriguez-Revenga L, Tran CW, Scheffer A, Steinfeld I, Tsang P, Yamada NA, Park HS, Kim JI, Seo JS, Yakhini Z, Laderman S, Bruhn L, Lee C. The fine-scale and complex architecture of human copy-number variation. Am J Hum Genet 2008;82:685-695.
8. McCarroll SA, Kuruvilla FG, Korn JM, Cawley S, Nemesh J, Wysoker A, Shapero MH, de Bakker PI, Maller JB, Kirby A, Elliott AL, Parkin M, Hubbell E, Webster T, Mei R, Veitch J, Collins PJ, Handsaker R, Lincoln S, Nizzari M, Blume J, Jones KW, Rava R, Daly MJ, Gabriel SB, Altshuler D. Integrated detection and population-genetic analysis of SNPs and copy number variation. Nat Genet 2008;40:1166-1174.