Student Background: Protein Structure and Enzyme Function
Enzymes are nature’s ultimate multi-taskers. In our cells, they catalyze over 4,000 chemical reactions! They convert what we eat into cellular energy; they aid in cell communication and help regulate cellular processes. In the outside world, man uses enzymes for our own purposes, such as making cheese, fermenting beer and tenderizing meat, just to name a few! Enzymes are marvelous tools. Just like the tools you use every day, enzymes have a specific structure that is crucial to their function. For example, think about what tool you would choose to eat your morning bowl of cereal. Would you choose a fork, a whisk, a spoon or a knife? Hopefully, you’ll choose a spoon; it is the best tool for the job at hand. What makes the spoon different from the other tools? They are all made of stainless steel and are all located in your utensil drawer. What’s makes each tool unique is their shape, it’s the unique shape that determines what each tool will be able to do. This is called the structure-function relationship. This relationship describes how the shape (structure) of a tool is related to its job (function). Enzymes are a specific type of protein and each is controlled by the structure-function relationship.
How Proteins Are Made
In your cells, proteins are made of building blocks called amino acids. There are 20 different amino acids. Think of the 20 amino acids as the “letters” of the protein language. See the table below for the list of all 20 amino acids as their abbreviations.
Alanine (Ala) / Glutamine (Gln) / Leucine (Leu) / Serine (Ser)Arginine (Arg) / Glutamic Acid (Glu) / Lysine (Lys) / Threonine (Thr)
Asparagine (Asp) / Glycine (Gly) / Methionine (Met) / Tyrosine (Tyr)
Aspartic Acid (Asp) / Histidine (His) / Phenylalanine (Phe) / Tryptophan (Trp)
Cysteine (Cys) / Isoleucine (Ile) / Proline (Pro) / Valine (Val)
In the English language, there are 26 letters of the alphabet that can be combined and rearranged to produce many different words. Proteins, like words, are built from unique combinations of these 20 amino acids “letters.”For example, the word “CAT” is spelled “C,” “A,” “T” and it cannot be spelled any other way. Rearrange the letters and you get TAC or ACT, neither of which describe the fluffy, whiskered critter you’re trying to describe. The letters of the alphabet are arranged the same way each time you spell a word. This is also true when building proteins.Every time a protein is made, the amino acids are arranged in the same order. The protein building process occurs in a part of the cell called a ribosome. There, the amino acids are placed in the proper order to produce the necessary protein.
How does the ribosome know how to “spell” the protein? That information comes from a messenger called the messenger RNA (mRNA). mRNA is a special molecule that delivers the information directly from the DNA itself right to the ribosome and it tells the ribosome exactly how to make the protein. It does this using a special code. This special code tells the ribosome which amino acids to use and what order to use them in. Here is what an mRNA might look like:
AUGUACAUUCAUAGGUCCAUUGAGGUCCUAGUAUAG
The mRNA is “read” by the ribosome in 3-letter units called codons, and each codon tells the ribosome which amino acid to use. See the table below that depicts the amino acid assigned to each possible 3 letter codon.
UUU / Phe / UCU / Ser / UAU / Tyr / UGU / CysUUC / Phe / UCC / Ser / UAC / Tyr / UGC / Cys
UUA / Leu / UCA / Ser / UAA / Stop / UGA / Stop
UUG / Leu / UCG / Ser / UAG / Stop / UGG / Trp
CUU / Leu / CCU / Pro / CAU / His / CGA / Arg
CUC / Leu / CCC / Pro / CAC / His / CGC / Arg
CUA / Leu / CCA / Pro / CAA / Gln / CGA / Arg
CUG / Leu / CCG / Pro / CAG / Gln / CGG / Arg
AUU / Ile / ACU / Thr / AAU / Asp / AGU / Ser
AUC / Ile / ACC / Thr / AAC / Asp / AGC / Ser
AUA / Ile / ACA / Thr / AAA / Lys / AGA / Arg
AUG / Met / ACG / Thr / AAG / Lys / AGG / Arg
GUU / Val / GCA / Ala / GAU / Asp / GGU / Gly
GUC / Val / GCC / Ala / GAC / Asp / GGC / Gly
GUA / Val / GCA / Ala / GAA / Glu / GGA / Gly
GUG / Val / GCG / Ala / GAG / Glu / GGG / Gly
Using the table, we can translate out mRNA code into an amino acid sequence.
mRNA: AUG UAC AUU CAU AGG UCC AUU GAG GUC CUA GUA UAG
Amino Acids:Met Tyr Ile His Arg Ser Ile Glu Val Leu Val Stop
The mRNA encoded for an 11 amino acid long protein. Notice that three different codons encode a “stop;” these codons tell the ribosome that the amino acid sequence is done. All of this takes place inside the ribosome. A ribosome is a part of the cell that is shaped somewhat like a mushroom, with a larger subunit that sits atop a smaller one. A groove between the large and subunit provides the perfect place for the mRNA to enter and be “read”.
It is inside the ribosome that the mRNA sequence is read and translated into an amino acid sequence. Each amino acid is attached to the next via a peptide bond. The sequence of amino acids “spells” the protein. Like a word in the English language, if a protein is spelled incorrectly, it’s not that protein anymore! C-A-T spells “CAT”. If an “R” is accidentally put in place of the “T,” you get “CAR”, which is a completely different thing than a “CAT!” The same is true for protein synthesis.
Protein Folding and Unfolding
Proteins are more complicated than just their amino acid sequence. Proteins aren’t simply shaped like strings of pearls where each pearl is a different amino acid. Instead, proteins fold into 3-dimensional globs based on interactions between the amino acids. This folding in combination with the amino acid sequence gives the protein its unique structure that will allow it to carry out its function. Oftentimes, proteins are described as units like a “lock and a key”. A lock can only be opened by a key of a particular shape. If you get home this afternoon and someone has changed your locks, your key won’t open the lock and you’ll be locked out! Proteins that aren’t in the right shape can’t do their jobs, just like keys that don’t fit their locks. Hemoglobin is an example of a protein that has a very specific shape to do its job. Hemoglobin carries oxygen in your blood. Specifically it carries 4 units of molecular oxygen due to 4 “grooves” in its 3-D shape. If hemoglobin isn’t shaped properly, it can’t carry oxygen. It is essential to newly made proteins get folded into their correct 3-D shape. With the help of some other cellular team-mates proteins get synthesized and folded correctly many times over each day in your cells!
Just as proteins are folded into their 3-D shapes, sometimes they can also become unfolded. This unfolding is a process called denaturation and it can render the protein useless because its shape has been distorted. Factors such as heat can denature proteins. Think of a raw egg. You know from a nutrition stand-point that eggs are full of proteins. Now, think of a hard-boiled egg. Structurally, they are very different. A raw egg is runny and a liquid, while a hard-boiled egg has a rubbery, solid feel. The high heat of the boiling process denatured the proteins in the egg and changed their 3-D structure. Not only is it changed, but there is no going back! You cannot put a hard-boiled egg in the refrigerator and get back the original liquid consistency. High temperatures and fluctuations in pH are the usual suspects when it comes to denatured proteins. Of course, denaturation isn’t always bad. A fever is your body’s way of “heating up” the environment in an attempt to denature the proteins of the “bug” that has infected you. In this way, denaturation of a foreign protein could protect you from illness. Denaturation will affect the protein structure, and in turn will affect its function. Think of that spoon from your morning cereal, if its shape suddenly “denatures” into a knife, you’re going to have some trouble eating your Wheaties!
Enzymes
Remember that enzymes are simply a group of a certain type of protein. Enzymes are proteins that catalyze chemical reactions. That is, they make chemical reactions happen faster. In fact, without enzymes, chemical reactions take place at a rate far too slow to support life in our cells! Enzymes are extremely reactive and very efficient. They are also very specific. That is, they do a specific job very well, but only that specific job. Thus, they are often named for exactly what is they do. In 1961, the International Union of Biochemistry put forth a naming system for enzymes. Enzymes typically end in “ase,” and are named for what they do. Therefore an enzyme that catalyzes the conversion of A into B would aptly be named “A to B ase” or “Atobase.”Enzymes are highly specific because they physically bind the substrate of the chemical reaction they catalyze. Remember that in a chemical reaction the substrate is what you start with (the molecules located on the left side of the arrow) and the product is what you end up with (the molecule(s) located on the right side of the arrow). In this example below
HCl + NaOH NaCl + H2O
The substrates are HCl and NaOH, while the products are NaCl and H2O. The enzyme that catalyzes this reaction would physically bind HCl and NaOH, therefore its shape is unique to being able to bind those two substrates and only those two substrates.
Pectinase is the name of the enzyme you’ll be working with in this unit. It is called pectinase because it breaks down pectin. Pectin is a material found in substantial quantities in all fruits and their juices. It is a very large molecule with repeats of the units shown below again and again. It is a polysaccharide, made of many molecules of simple sugars and it is found in the cell walls of plants. Pectinase is commonly used in the food industry to extract and clarify juices from fruits. It aids in the breakdown of pectin by specifically targeting the oxygen bonds between the simple sugars.
Protein Structure and Enzyme FunctionPage 1 of 5 / Contextual Biology Integrated Projects
Created by the Center for Occupational Research and Development