Song et al. Page 1
Supplementary TableS1.Telomeric silencing associated with histone ubiquitylation and methylation, related to supplementary Fig.S3 and S4.
TEL05R / TEL07LGene Deletion / Phenotype / Reference / Phenotypea / Phenotypeb / Reference
RAD6 / ++ / [1,2] / +++++ / +++++++ / [2,3]
BRE1 / ++ / +++++ / +++++++ / [3]
LGE1 / ++ / +++++ / ++++++
UBP8 / NC / NC / NC / [4]
UBP10 / NC / +++ / NC / [4,5,6]
SET1 / ++ / [7] / +++++ / ++++++ / [8,9,10]
SET2 / −−− / − / −− / [9]
DOT1 / ++ / [11] / +++++ / ++++ / [5,9,11,12]
SIR2 / ++ / [1] / +++++ / +++++++ / [13,14]
RPD3 / −−−−−− / [1] / −−− / −−−− / [15]
A summary of the silencing phenotypes at the telomere-proximal regions in various deletion lines. Rad6 is an E2 ubiquitin-conjugating enzyme, and Bre1 is an E3 ubiquitin ligase; Ubp8 and Ubp10are histone H2B deubiquitylases. Lge1 is a Bre1-associated protein that promotes H2B ubiquitylation[16]. Set1, Set2, and Dot1 are histone H3 lysine methyltransferases that methylate lysine residues at lysine 4, lysine 36, and lysine 79, respectively. Strains lacking Sir2or Rpd3were used as controls. TEL05R, the right-end telomere of chromosome V; TEL07L, the left-end telomere of chromosome VII; +, increase in URA3 expression caused by a disruption of silencing; −, decrease in URA3 expression caused by enhanced silencing; NC, no change.aUCC1111 background. bUCC1001 background.
Supplementary TableS2.rDNAsilencing associated with histone ubiquitylation and methylation, related to supplementary Fig. S3.
rDNAGene Deletion / Phenotype / Reference
RAD6 / +++ / [17]
BRE1 / ++
LGE1 / ++
UBP8 / −−−−
UBP10 / ++ / [5]
SET1 / ++ / [7]
SET2 / −−−−
DOT1 / NC / [5]
SIR2 / ++ / [1,13,18]
RPD3 / −−−− / [1,18]
A summary of the silencing phenotypes at the rDNA locus in various deletion lines.Strains lacking Sir2or Rpd3were used as controls for this assay. SeesupplementaryTable S1for details.
Supplementary TableS3.HM silencing associated with histone ubiquitylation and methylation, related to supplementary Fig. S3 and S4.
HMR / HMLGene Deletion / Phenotype / Reference / Phenotype / Reference
RAD6 / +++++ / [2] / +++++ / [2]
BRE1 / +++++ / +++++++
LGE1 / +++++ / +++++++
UBP8 / NC / NC
UBP10 / + / [5] / NC / [5]
SET1 / +++++ / [7] / ++++ / [7]
SET2 / −−− / [19] / NC
DOT1 / +++++ / [5] / + / [5]
SIR2 / +++++ / [20] / +++++++ / [13]
RPD3 / −−−− / [21] / −−−−−
A summary of the silencing phenotypes at the HM loci in various deletion lines. Strains lacking Sir2or Rpd3were used as controls for this assay. Seesupplementary Table S1for details.
Supplementary TableS4.Strains used in this study.
Figure / Strain / Genotype / Source / Note (Reference)Fig. 1 / YKH045 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 htb1-1 htb2-1 pRS314[FLAG-HTB1-CEN-TRP1] pRG145[GAPDHprom-3HA-UBI4-URA3Integrative] / Jerry L.WorkmanShelley L. Berger / [22,23]
Fig.2A / BY4741 / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0
FY124 / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 rad6Δ::KanMX4 / Euroscarf
FY127 / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0bre1Δ::KanMX4 / Euroscarf
FY167 / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0lge1Δ::KanMX4 / Euroscarf
Fig. 2B / Y131 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 can1-100hta1Δ-htb1Δ::LEU2hta2Δ-htb2Δ::URA3 (non-functional)pRS426-HTA1-HTB1 / Mary Ann Osley / [24]
Y133 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 can1-100hta1Δ-htb1Δ::LEU2hta2Δ-htb2Δ::URA3(non-functional)pRS426-HTA1-htb1-K123R / Mary Ann Osley / [24]
YZS276 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 can1-100hta1Δ-htb1Δ::LEU2hta2Δ-htb2Δ::URA3(non-functional)pRS413-HTA1-FLAG-HTB1 / Mary Ann OsleyC. David Allis / [25,26]
YZS277 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 can1-100hta1Δ-htb1Δ::LEU2hta2Δ-htb2Δ::URA3(non-functional)pRS413-HTA1-FLAG-htb1-K123R / Mary Ann OsleyC. David Allis / [25,26]
Fig. 2C / YKH045 / See Fig. 1
YKH046 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 htb1-1 htb2-1 pRS314[FLAG-htb1-K123R-CEN-TRP1] pRG145[GAPDHprom-3HA-UBI4-URA3Integrative] / Jerry L.WorkmanShelley L. Berger / [22,23]
YKH047 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 htb1-1 htb2-1 ubp8Δ::KanMX4pRS314[FLAG-HTB1-CEN-TRP1] pRG145[GAPDHprom-3HA-UBI4-URA3Integrative] / Jerry L.WorkmanShelley L. Berger / [22,23]
Fig. 2D / BY4741 / See Fig. 2A
FY231 / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0ubp8Δ::KanMX4 / Euroscarf
SY387a / MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0ubp10Δ::KanMX6 / This study / FromBY4741
Fig. 2E / YKH045 / See Fig. 1
SY390 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 htb1-1 htb2-1 sir2Δ::KanMX4pRS314[FLAG-HTB1-CEN-TRP1]pRG145[GAPDHprom-3HA-UBI4-URA3Integrative] / This study / From
YKH045
SY394 / MATa ura3-1 leu2-3,112 his3-11,15 trp1-1 ade2-1 htb1-1 htb2-1 sir2Δ::KanMX4pRS314[FLAG-htb1-K123R-CEN-TRP1]pRG145[GAPDHprom-3HA-UBI4-URA3 Integrative] / This study / From
YKH046
Fig. 3 / BY4741 / See Fig. 2A
FY124 / See Fig. 2A
FY127 / See Fig. 2A
FY231 / See Fig. 2D
SY387 / See Fig. 2D
Fig. S1 and S2 / YKH045 / See Fig. 1
Fig. S3A / UCC1111 / MATa ura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2pRS412 (ADE2 CEN ARS)-HHF2-HHT2 / Kevin StruhlMark R. Parthun / [11,27]
SY420 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2rad6Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY421 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2bre1Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY422 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2lge1Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY423 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2ubp8Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY424 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2ubp10Δ::KanMX6pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY238 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2sir2Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY365 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2rpd3Δ::KanMX6 pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY189 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15hhf1-hht1::LEU2set1Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY190 / MATaura3Δ0leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0 adh4::URA3-TEL (VII-L) hhf2-hht2::MET15 hhf1-hht1::LEU2 set2Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
SY191 / MATaura3Δ0 leu2Δ0 trp1Δ63 his3Δ200 ade2Δ::hisG lys2Δ0 met15Δ0adh4::URA3-TEL (VII-L) hhf2-hht2::MET15 hhf1-hht1::LEU2 dot1Δ::KanMX4pRS412(ADE2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1111
Fig. S3B / UCC1188 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / DanielE. Gottschling / [12]
SY469 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 rad6Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY470 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 bre1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY471 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 lge1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY472 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 ubp8Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY473 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3)his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 ubp10Δ::KanMX6 pMP9 (LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY345 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 sir2Δ::KanMX4 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY368 / MATa ura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3)his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 rpd3Δ::KanMX6 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY474 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 set1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY475 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 set2Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
SY476 / MATaura3(-52 or -167)leu2Δ1trp1(Δ901 or ::HIS3) his3Δ200 lys2-801 RDN1::URA3 hhf2-hht2::HIS3 hhf1-hht1::LEU2 dot1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC1188
Fig. S3C / UCC7262 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2pMP9(LYS2 CEN ARS)-HHF2-HHT2 / Daniel E. Gottschling / [12]
SY445 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 rad6Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY446 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 bre1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY447 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 lge1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY448 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 ubp8Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY449 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 ubp10Δ::KanMX6 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY346 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 sir2Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY369 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 rpd3Δ::KanMX6 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY450 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 set1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY451 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 set2Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
SY452 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63his3Δ200ade2(::hisG or -101)met15Δ0 or MET15 lys2(Δ0 or -801) ADE2-TEL-VR hmr::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 dot1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7262
Fig. S4A / UCC1001 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 / E.J. ChoDaniel E. Gottschling / [28,29]
SY425 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801 ade2-101TELadh4::URA3 rad6Δ::KanMX4 / This study / From UCC1001
SY426 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3bre1Δ::KanMX4 / This study / From UCC1001
SY427 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3lge1Δ::KanMX4 / This study / From UCC1001
SY428 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 ubp8Δ::KanMX4 / This study / From UCC1001
SY429 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 ubp10Δ::KanMX6 / This study / From UCC1001
SY049 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 sir2Δ::KanMX4 / This study / From UCC1001
SY432 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 rpd3Δ::KanMX6 / This study / From UCC1001
SY430 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801 ade2-101TELadh4::URA3set1Δ::KanMX4 / This study / From UCC1001
SY431 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 set2Δ::KanMX4 / This study / From UCC1001
SY067 / MATaura3-52leu2Δ1trp1Δ1his3Δ200lys2-801ade2-101TELadh4::URA3 dot1Δ::KanMX4 / This study / From UCC1001
Fig. S4B / UCC506 / MATaura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VR / Daniel E. Gottschling / [30]
SY433 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRrad6Δ::KanMX4 / This study / From
UCC506
SY434 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRbre1Δ::KanMX4 / This study / From
UCC506
SY435 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRlge1Δ::KanMX4 / This study / From
UCC506
SY436 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRubp8Δ::KanMX4 / This study / From
UCC506
SY437 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRubp10Δ::KanMX6 / This study / From
UCC506
SY344 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRsir2Δ::KanMX4 / This study / From
UCC506
SY367 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VRrpd3Δ::KanMX6 / This study / From
UCC506
SY438 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VR set1Δ::KanMX4 / This study / From UCC506
SY439 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VR set2Δ::KanMX4 / This study / From UCC506
SY440 / MATa ura3-52 leu2Δ1trp1Δ1 his3Δ200 lys2-801ade2-101URA3-TEL-VR dot1Δ::KanMX4 / This study / From UCC506
Fig. S4C / UCC7266 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2pMP9(LYS2 CEN ARS)-HHF2-HHT2 / Daniel E. Gottschling / [12]
SY457 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 rad6Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY458 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 bre1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY459 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 lge1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY460 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 ubp8Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY461 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 ubp10Δ::KanMX6 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY347 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 sir2Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY370 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 rpd3Δ::KanMX6 pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY462 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 set1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY463 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 set2Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
SY464 / MATaura3(Δ0 or -52)leu2(Δ0or Δ1)trp1Δ63 his3Δ200lys2(Δ0 or -801) ADE2-TEL-VR hml::URA3 hhf2-hht2::MET15 hhf1-hht1::LEU2 dot1Δ::KanMX4pMP9(LYS2 CEN ARS)-HHF2-HHT2 / This study / From
UCC7266
Fig. S5 / UCC1111 / See Fig. S3A
SY420 / See Fig. S3A
SY421 / See Fig. S3A
SY423 / See Fig. S3A
SY424 / See Fig. S3A
aThe deletion strain UBP10 (SY387) was generated by replacing the open reading frame of UBP10 with the KanMX6 marker using the pFA6-KanMX6 plasmid [31]. For the other gene deletion strains, each indicated gene was deleted by high efficiency transformation using PCR products amplified from genomic DNA in which the target gene of interest had already been replaced by KanMX4 (Euroscarf, Frankfurt, Germany). All deletion strains were confirmed by PCR using gene-specific and deletion cassette-specific primers.
Supplementary TableS5.oligonucleotide sequencesused in ChIP.
Fig. / Name / Sequence / SourceFig. 1B / TEL05R-1-for (5385-5407) / TGTAGACCATCACGTGGTTTGTT / [32]
TEL05R-1-rev (5432-5454) / CGTTTGTTGAAGACGAACCAGAT / [32]
TEL05R-2-for (6648-6671) / CATCCATCCCTCTACTTCCTACCA / [32]
TEL05R-2-rev (6703-6725) / TGGAGTTGGATATGGGTAATTGG / [32]
TEL05R-3-for (6867-6888) / TGCCATACTCACCCTCACTTGT / [32]
TEL05R-3-rev (6947-6970) / CCATGGAGTGGAATGTGAGAGTAG / [32]
TEL06R-1-for (74-93) / ACCCAGTCCTCATTTCCATC / [33]
TEL06R-1-rev (323-344) / TTTTTACGTTTAGCTGAGTTTA / [33]
TEL06R-2-for (496-516) / ATCCTTAAGTAAAACACATTC / [33]
TEL06R-2-rev (768-787) / AGGATTTTAGCAACGACTTC / [33]
TEL06R-3-for (7388-7411) / CATTGTGGCACTATTAACGAGAGG / [33]
TEL06R-3-rev (7632-7651) / ATGCGAAATAAGAACACGAT / [33]
TEL07L-1-for (148-177) / AACCACCATCCATCTCTCTACTTACTACTA / [32]
TEL07L-1-rev (263-289) / AGAACAACAGTACAGTGAGTAGGACATG / [32]
TEL07L-2-for (492-515) / TCAGTACTAAATGCACCCACATCA / [32]
TEL07L-2-rev (542-564) / TGGGTAAATGGCACAGGGTATAG / [32]
Fig.3 / See Fig. 1B
Fig. S1C and S1D / See Fig. 1B
rDNA-1-for
(ChXII 463118-463137) / GTGGTGTCTGATGAGCGTGT / [34]
rDNA-1-rev
(ChXII 463344-463363) / TCCCTCAGGATAGCAGAAGC / [34]
rDNA-2-for
(ChXII 460408-460427) / TCCCCACTGTTCACTGTTCA / [34]
rDNA-2-rev
(ChXII 460632-460651) / AGGGCTTTCACAAAGCTTCC / [34]
rDNA-3-for
(ChXII 459359-459378) / GCCACCATCCATTTGTCTTT / [34]
rDNA-3-rev
(ChXII 459590-459609) / GAGGTGTTATGGGTGGAGGA / [34]
rDNA-4-for
(ChXII 458177-458196) / AAGATGCCCACGATGAGACT / [34]
rDNA-4-rev
(ChXII 458425-458444) / GGGAGGTACTTCATGCGAAA / [34]
HMR-1-for
(ChIII293848-293872) / GTAGTATGGCGGAAAACATAAACAG / [35]
HMR-1-rev
(ChIII 294338-294362) / AGAAAAACCCGACTATGCTATTTTA / [35]
Fig.S2 / See Fig. S1
Fig. S5 / TEL07L-URA3-1-for
(123- 144)a / CCCAGCCTGCTTTTCTGTAACG / This study
TEL07L-URA3-1-rev
(306-329)a / TGGGTGGAAGAGATGAAGGTTACG / This study
TEL07L-URA3-2-for
(732- 756)a / TGGGACCTAATGCTTCAACTAACTC / This study
TEL07L-URA3-2-rev
(1003-1024)a / GGAAGAACGAAGGAAGGAGCAC / This study
TEL07L-URA3-3-for
(4912- 4933)a / ATTTCCTCTCCCTGCCATCCTC / This study
TEL07L-URA3-3-rev
(5141-5164)a / GCTCTCCTCCCACAAAATAATCTT / This study
TEL07L-URA3-4-for
(15987-16009)a / GAATAATCGGCTGTAATCGGACC / This study
TEL07L-URA3-4-rev
(16261-16281)a / ACCAACCGGATCAGGCAAGAC / This study
Fig.1B,3, S1, S2, and S5 / ChrV NO-ORF-forb / GGCTGTCAGAATATGGGGCCGTAGTA / [36,37]
ChrV NO-ORF-revb / CACCCCGAAGCTGCTTTCACAATAC / [36,37]
The primer locations denote the distance from the TG1-3repeats at the end of each chromosome (+1), unless otherwise indicated.
aThe nucleotide numbers are relative to the first nucleotide of the URA3 initiation codon (+1).
bPrimers used to amplify the non-transcribed regions of chromosome V.
Supplementary TableS6.Antibodies used in this study.
Specificity / Supplier / Catalog # / ApplicationsAnti-H3 / Abcam / ab1791 / ChIP
Anti-H3K4me3 / Abcam / ab8580 / ChIP
Anti-H3K36me3 / Abcam / ab9050 / ChIP
Anti-H3K79me3 / Abcam / ab2621 / ChIP
Anti-H4 / Abcam / ab31827 / ChIP, WB
Anti-H4K16ac / Millipore / 07-329 / ChIP, WB
Anti-Sir2 / Santa Cruz Biotechnology / sc-6666 / ChIP, WB
Anti-HA / Roche / 12CA5 / ChIP
Supplementary TableS7.Mean lifespans and p-values for lifespan analysis, related to Fig. 2.
Figure / Strain A / Strain B / p-valuesName / Meana / nb / Name / Meana / nb
Fig. 2A / WT (BY4741) / 24.5 / 50 / rad6∆ / 12.1 / 48 / 1.5×10-11
WT (BY4741) / 24.5 / 50 / bre1∆ / 12.4 / 48 / 5.5×10-12
WT (BY4741) / 24.5 / 50 / lge1∆ / 18.5 / 48 / 6.1×10-3
Fig. 2B / HTA1-HTB1,CEN
(YZS276) / 21.4 / 50 / HTA1-htb1-K123R,CEN ( YZS277) / 13.3 / 50 / 6.9×10-7
HTA1-HTB1,CEN
( YZS276) / 21.4 / 50 / HTA1-HTB1, 2μ
(Y131) / 13.6 / 38 / 6.2×10-5
HTA1-HTB1,CEN
( YZS276) / 21.4 / 50 / HTA1-htb1-K123R, 2μ
(Y133) / 12.0 / 39 / 2.3×10-7
Fig. 2C / WT (YKH045) / 15.9 / 49 / htb1-K123R (YKH046) / 10.2 / 50 / 1.7×10-3
WT (YKH045) / 15.9 / 49 / ubp8∆ (YKH047) / 19.0 / 49 / 0.12
Fig. 2D / WT (BY4741) / 36.3 / 50 / ubp8∆ / 40.8 / 46 / 0.27
WT (BY4741) / 36.3 / 50 / ubp10∆ / 26.3 / 49 / 1.5×10-3
Fig. 2E / WT (YKH045) / 18.4 / 50 / sir2∆ / 11.7 / 46 / 6.1×10-5
WT (YKH045) / 18.4 / 50 / sir2∆+ htb1-K123R / 10.0 / 50 / 2.2×10-6
sir2∆ / 11.7 / 46 / sir2∆+ htb1-K123R / 10.0 / 50 / 0.14
aMean lifespan;bnumber of cells analyzed in each experiment.
Supplementary legends
Supplementary Fig. S1.Histone levels at the telomere, rDNA and HMR Loci were decreased in aged Cells, related to Fig. 1. (A) Western blot analysis of extracts from young and aged cells (strain YKH045) using the indicated antibodies. The membrane was stained with Ponceau S as a loading control (bottom).Average bud scar numbers for both types of cells are shown in parentheses. (B) Schematic diagrams of the TEL05R, TEL06R,TEL07L, HMR, and rDNA loci.The bars and numbers below each locus show the positions of the PCR products used in ChIP analysis.(C) ChIP analysis of histones H3, H4, and H2B at the TEL06R, rDNA, and HMR locias described in Fig. 1B. Quantitative histone levels were used to normalize the ChIP results for acetylated H4 and methylated H3 in Fig. 1B and supplementary Fig.S1D. (D) ChIP analysis of telomere-proximal regions in young and aged cells(strain YKH045). Antibodies against Sir2 and H4K16ac were used to immunoprecipitate chromatin.The results for acetylated H4 were further normalized to the total H4 signals.
Supplementary Fig. S2. Changes in Sir2 levels and histone modifications at the rDNA and HMRLoci in aged Cells, related to Fig. 1. (A-B) ChIP analysis of rDNA (A) and HMR(B) regions in young and aged cells(strain YKH045). Antibodies against Sir2, H4K16ac, H3K4me3, H3K36me3, and H3K79me3 were used to immunoprecipitate chromatin.To analyze the levels of ubiquitylated H2B, a ChDIP assay was carried out as described in Fig. 1B. All methods and procedures were performed as described in Fig. 1.
Supplementary Fig. S3. Histone H2B ubiquitylation and H3 lysine methylation regulate Sir2-mediated heterochromatin silencing. (A-C) To examine silencing at the telomeric, rDNA, and HMR regions, the indicated genes were deleted in strains UCC1111, UCC1188, and UCC7262, all of which contain a URA3 reporter gene, as shown in the diagram. Exponentially growing cells were spotted onto SC, SC-Ura, and 5-FOA plates at 5-fold dilutions and further incubated at 30°C for 1-3 days. Strains lacking SIR2 or RPD3 were used as controls.
Supplementary Fig. S4. Histone H2B ubiquitylation and H3 lysine methylation regulate Sir2-mediated heterochromatic silencing. (A-C) To determinesilencing at telomeric and HML regions, the indicated genes were deleted in strains UCC1001, UCC506, and UCC7266, all of which contain a URA3 reporter gene, as shown in the diagram. All methods and procedures were performed as described in supplementary Fig.S3.
Supplementary Fig. S5. Histone H2B ubiquitylation regulates Sir2 association at the URA3-based TEL07L region, related to Fig. 3. (A) A schematic diagram of the URA3 reporter at TEL07L is shown in the top panel.The bars and numbers below the subtelomeric region show the positions of the PCR products used for the ChIP analysis and their distances from the telomeric DNA sequence (TG1-3). Sir2 recruitment and histone H4K16ac were analyzed by ChIP in WT, rad6Δ, bre1Δ, ubp8Δ, and ubp10Δcells. (B) Quantitation of the ChIP experiments in (A). The PCR signals were quantitated and normalized as described in Fig. 1B. The error bars indicate the standard deviation (S.D.) of three PCRs from two independent chromatin preparations.
SupplementalReferences
[1] Z.-W. Sun, M. Hampsey, A general requirement for the Sin3-Rpd3 histone deacetylase complex in regulating silencing in Saccharomyces cerevisiae, Genetics 152 (1999) 921-932.
[2] H. Huang, A. Kahana, D.E. Gottschling, L. Prakash, S.W. Liebman, The ubiquitin-conjugating enzyme Rad6 (Ubc2) is required for silencing in Saccharomyces cerevisiae, Molecular and cellular biology 17 (1997) 6693-6699.
[3] A. Wood, N.J. Krogan, J. Dover, J. Schneider, J. Heidt, M.A. Boateng, K. Dean, A. Golshani, Y. Zhang, J.F. Greenblatt, Bre1, an E3 ubiquitin ligase required for recruitment and substrate selection of Rad6 at a promoter, Molecular cell 11 (2003) 267-274.
[4] R.G. Gardner, Z.W. Nelson, D.E. Gottschling, Ubp10/Dot4p regulates the persistence of ubiquitinated histone H2B: distinct roles in telomeric silencing and general chromatin, Molecular and cellular biology 25 (2005) 6123-6139.
[5] M.S. Singer, A. Kahana, A.J. Wolf, L.L. Meisinger, S.E. Peterson, C. Goggin, M. Mahowald, D.E. Gottschling, Identification of high-copy disruptors of telomeric silencing in Saccharomyces cerevisiae, Genetics 150 (1998) 613-632.
[6] S. Qin, Q. Wang, A. Ray, G. Wani, Q. Zhao, S.R. Bhaumik, A.A. Wani, Sem1p and Ubp6p orchestrate telomeric silencing by modulating histone H2B ubiquitination and H3 acetylation, Nucleic acids research 37 (2009) 1843-1853.
[7] I.M. Fingerman, C.-L. Wu, B.D. Wilson, S.D. Briggs, Global loss of Set1-mediated H3 Lys4 trimethylation is associated with silencing defects in Saccharomyces cerevisiae, Journal of Biological Chemistry 280 (2005) 28761-28765.
[8] C. Nislow, E. Ray, L. Pillus, SET1, A Yeast Member of theTrithorax Family, Functions in Transcriptional Silencing and Diverse Cellular Processes, Molecular biology of the cell 8 (1997) 2421-2436.
[9] K.F. Verzijlbergen, A.W. Faber, I.J. Stulemeijer, F. van Leeuwen, Multiple histone modifications in euchromatin promote heterochromatin formation by redundant mechanisms in Saccharomyces cerevisiae, BMC molecular biology 10 (2009) 76.
[10] P.L. Nagy, J. Griesenbeck, R.D. Kornberg, M.L. Cleary, A trithorax-group complex purified from Saccharomyces cerevisiae is required for methylation of histone H3, Proceedings of the national academy of sciences 99 (2002) 90-94.
[11] H.H. Ng, Q. Feng, H. Wang, H. Erdjument-Bromage, P. Tempst, Y. Zhang, K. Struhl, Lysine methylation within the globular domain of histone H3 by Dot1 is important for telomeric silencing and Sir protein association, Genes & development 16 (2002) 1518-1527.
[12] F. van Leeuwen, P.R. Gafken, D.E. Gottschling, Dot1p modulates silencing in yeast by methylation of the nucleosome core, Cell 109 (2002) 745-756.
[13] J.M. Sherman, E.M. Stone, L.L. Freeman-Cook, C.B. Brachmann, J.D. Boeke, L. Pillus, The conserved core of a human SIR2 homologue functions in yeast silencing, Molecular biology of the cell 10 (1999) 3045-3059.
[14] S.N. Garcia, L. Pillus, A unique class of conditional sir2 mutants displays distinct silencing defects in Saccharomyces cerevisiae, Genetics 162 (2002) 721-736.
[15] M.C. Keogh, S.K. Kurdistani, S.A. Morris, S.H. Ahn, V. Podolny, S.R. Collins, M. Schuldiner, K. Chin, T. Punna, N.J. Thompson, C. Boone, A. Emili, J.S. Weissman, T.R. Hughes, B.D. Strahl, M. Grunstein, J.F. Greenblatt, S. Buratowski, N.J. Krogan, Cotranscriptional set2 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex, Cell 123 (2005) 593-605.
[16] Y.-H. Song, S.H. Ahn, A Bre1-associated protein, large 1 (Lge1), promotes H2B ubiquitylation during the early stages of transcription elongation, Journal of Biological Chemistry 285 (2010) 2361-2367.
[17] M. Bryk, M. Banerjee, M. Murphy, K.E. Knudsen, D.J. Garfinkel, M.J. Curcio, Transcriptional silencing of Ty1 elements in the RDN1 locus of yeast, Genes & development 11 (1997) 255-269.
[18] J.S. Smith, E. Caputo, J.D. Boeke, A genetic screen for ribosomal DNA silencing defects identifies multiple DNA replication and chromatin-modulating factors, Molecular and cellular biology 19 (1999) 3184-3197.
[19] R. Tompa, H.D. Madhani, Histone H3 lysine 36 methylation antagonizes silencing in Saccharomyces cerevisiae independently of the Rpd3S histone deacetylase complex, Genetics 175 (2007) 585-593.
[20] G. Cuperus, R. Shafaatian, D. Shore, Locus specificity determinants in the multifunctional yeast silencing protein Sir2, The EMBO journal 19 (2000) 2641-2651.
[21] J. Zhou, B.O. Zhou, B.A. Lenzmeier, J.-Q. Zhou, Histone deacetylase Rpd3 antagonizes Sir2-dependent silent chromatin propagation, Nucleic acids research 37 (2009) 3699-3713.
[22] K.K. Lee, L. Florens, S.K. Swanson, M.P. Washburn, J.L. Workman, The deubiquitylation activity of Ubp8 is dependent upon Sgf11 and its association with the SAGA complex, Molecular and cellular biology 25 (2005) 1173-1182.
[23] K.W. Henry, A. Wyce, W.-S. Lo, L.J. Duggan, N.T. Emre, C.-F. Kao, L. Pillus, A. Shilatifard, M.A. Osley, S.L. Berger, Transcriptional activation via sequential histone H2B ubiquitylation and deubiquitylation, mediated by SAGA-associated Ubp8, Genes & development 17 (2003) 2648-2663.
[24] K. Robzyk, J. Recht, M.A. Osley, Rad6-dependent ubiquitination of histone H2B in yeast, Science 287 (2000) 501-504.
[25] Z.-W. Sun, C.D. Allis, Ubiquitination of histone H2B regulates H3 methylation and gene silencing in yeast, Nature 418 (2002) 104-108.
[26] T. Xiao, C.-F. Kao, N.J. Krogan, Z.-W. Sun, J.F. Greenblatt, M.A. Osley, B.D. Strahl, Histone H2B ubiquitylation is associated with elongating RNA polymerase II, Molecular and cellular biology 25 (2005) 637-651.
[27] T.J. Kelly, S. Qin, D.E. Gottschling, M.R. Parthun, Type B histone acetyltransferase Hat1p participates in telomeric silencing, Molecular and cellular biology 20 (2000) 7051-7058.
[28] J.-H. Seol, H.-J. Kim, Y.-J. Yang, S.-T. Kim, H.-D. Youn, J.-W. Han, H.-W. Lee, E.-J. Cho, Different roles of histone H3 lysine 4 methylation in chromatin maintenance, Biochemical and biophysical research communications 349 (2006) 463-470.
[29] D.E. Gottschling, Telomere-proximal DNA in Saccharomyces cerevisiae is refractory to methyltransferase activity in vivo, Proceedings of the National Academy of Sciences 89 (1992) 4062-4065.
[30] H. Renauld, O.M. Aparicio, P.D. Zierath, B.L. Billington, S.K. Chhablani, D.E. Gottschling, Silent domains are assembled continuously from the telomere and are defined by promoter distance and strength, and by SIR3 dosage, Genes & development 7 (1993) 1133-1145.
[31] M.S. Longtine, A. McKenzie, 3rd, D.J. Demarini, N.G. Shah, A. Wach, A. Brachat, P. Philippsen, J.R. Pringle, Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae, Yeast 14 (1998) 953-961.
[32] W. Dang, K.K. Steffen, R. Perry, J.A. Dorsey, F.B. Johnson, A. Shilatifard, M. Kaeberlein, B.K. Kennedy, S.L. Berger, Histone H4 lysine 16 acetylation regulates cellular lifespan, Nature 459 (2009) 802-807.
[33] J.H. Park, S.H. Ahn, IMP dehydrogenase is recruited to the transcription complex through serine 2 phosphorylation of RNA polymerase II, Biochemical and biophysical research communications 392 (2010) 588-592.
[34] J. Huang, I.L. Brito, J. Villén, S.P. Gygi, A. Amon, D. Moazed, Inhibition of homologous recombination by a cohesin-associated clamp complex recruited to the rDNA recombination enhancer, Genes & development 20 (2006) 2887-2901.
[35] Z. Zhang, M.K. Hayashi, O. Merkel, B. Stillman, R.-M. Xu, Structure and function of the BAH-containing domain of Orc1p in epigenetic silencing, The EMBO journal 21 (2002) 4600-4611.
[36] S.H. Ahn, M.C. Keogh, S. Buratowski, Ctk1 promotes dissociation of basal transcription factors from elongating RNA polymerase II, The EMBO journal 28 (2009) 205-212.
[37] S.H. Ahn, M. Kim, S. Buratowski, Phosphorylation of serine 2 within the RNA polymerase II C-terminal domain couples transcription and 3' end processing, Molecular cell 13 (2004) 67-76.
Histone Ubiquitylation Regulates Lifespan