Snail mediates crosstalk between TGFβ and LXRα in hepatocellular carcinoma

Claudia Bellomo, Laia Caja, Isabel Fabregat, Wolfgang Mikulits, Dimitris Kardassis, Carl-Henrik Heldin and Aristidis Moustakas

Supplementary information

Table S1. Human primer sequences used for quantitative real-time PCR

GENE / Forward / Reverse
GAPDH / GGAGTCAACGGATTTGGTCGTA / GGAGTCAACGGATTTGGTCGTA
LXRα / CCACCGAGACTTCTGGACAGG / GCAGAGTCAGGAGGAATGTCAGG
LXR / AGCACAGACTGGGTCATCCC / AGCACGTTGTAGTGGAAGCC
SERPINE1 / CAGAGGTGGAAAGAGCCAGA / GAGGTCCACTTCAGTCTCCA
SNAI1 / CACTATGCCGCGCTCTTTC / GCTGGAAGGTAAACTCTGGATTAGA
BCL2 / AGGCTGGGATGCCTTTGTGG / TTTGTTTGGGGCAGGCATGT
MCL1 / TAAACAAAGAGGCTGGGATGGG / TGCCACCTTCTAGGTCCTCTAC
NOX4 / CCTCAACTGCAGCCTTATCC / CAACAATCTCCTGGTTCTCC
ABCA1 / ACATCTGGTTCTATGCCCGC / TCTGCATTCCACCTGACAGC
SREBP1C / CGGAGCCATGGATTGCAC / CTTCAAGAGAGGAGCTCAATGTGG

Supplementary Figures.

Supplementary Figure S1. Time course of LXRα and LXRβ expression in response toTGFβ in various HCC cell models.PLC/PRF5 (blue graphs), HUH7 (yellow graphs), Snu423 (orange graphs), HLE (purple graphs) and HLF (brown graphs) cells were treated at selected time points with TGFβ1 (5 ng/ml). The expression of LXRα, LXRβ and SERPINE1/PAI1 genes were assessed via Real Time PCR and data are presented as in figure 1b.Results are shown as mean±SD, and basal expression levels set to 1 correspond to different absolute levels of expression for each mRNA in each cell model. Experiments performed in biological duplicate,each of them intechnical triplicate. Statistical significance was assessed by one-way Anova, significance assigned as * p< 0.05, ** p< 0.01***, p< 0.001.

Supplementary Figure S2. Antagonism of LXRα and TGFβ on Snail expression in mesenchymal HCC cells.PLC/PRF5 (blue graphs), HUH7 (yellow graphs), Snu423 (orange graphs), HLE (purple graphs) and HLF (brown graphs) cells were treated at selected time points, as described in the methods. The expression of SNAI1 and SERPINE1/PAI1 genes were assessed via Real Time PCR and data are presented as in Figure 1b. Results are shown as mean±SD, and basal expression levels set to 1 correspond to different absolute levels of expression for each mRNA in each cell model.Experiments performed in biological duplicate,each of them intechnical triplicate. Statistical significance was assessed by one-way Anova, and assigned as *** p< 0.001.

Supplementary Figure S3.Specificity controls of LXR action.(a)HepG2 cells were transfected with ABCA1-luciferase reporter for and β-gal plasmid for 48 h, then treated in starvation medium with T0901317 or WYE7672 (LXR agonists) or GSK3987 (LXR antagonist) at final concentration 5 μM for 24 h, prior to luciferase and β-galactoside activity detection.Mean±SDof normalized activity values are plotted, and activity levels set to 1 correspond to the control condition in the presence of DMSO (vehicle). Experiments performed in biological triplicate,each of them intechnical quadruplicate. (b) Snu449 cells were treated in starvation medium with T0901317 or WYE7672 or GSK3987 at final concentration 5 μM for 24 h and the expression of the indicated genes was assessed via Real Time PCR. Results are shown as mean±SD, and basal expression levels set to 1 correspond to different absolute levels of expression for each mRNA in the control condition. Experiments performed in biological triplicate,each of them intechnical triplicate. (c,d) HepG2 and Snu449 cells were transfected with siControl non-targeting or siLXRα targeting siRNA at a final concentration of 30 nM. Cells were treated in starvation medium with or without T0901317 (T09, 5 μM) for 24 h and the expression of the indicated genes was assessed via Real Time PCR. Results are shown as mean±SD, and basal expression levels set to 1 correspond to different absolute levels of expression for each mRNA in the siCtrl condition. Experiments performed in biological triplicate,each of them intechnical triplicate. (e)HepG2 cells were transfected pCDNA3, pCDNA3-LXRα full length or pCDNA3-LXRα trunc and Snail-luciferase reporter for 48 h, then treated in starvation medium with TGFβ1 (5 ng/ml) with or without T0901317 (T09, 5 μM) for 24 h, prior to luciferase and β-galactosidase activity detection.Mean±SDof normalized activity values are plotted, and activity levels set to 1 correspond to the control condition in the presence of DMSO (vehicle) and pCDNA3. Experiments performed in biological triplicate,each of them intechnical quadruplicate. Statistical significance assessed by one-way (b-d) or two-way (a, e) Anova. Significance was assigned as * p<0.05, ** p< 0.01, *** p< 0.001. Immunoblotting for detection of MYC-tagged LXRα full length or MYC-LXRα truncated, Flag-tagged Smad3 and Smad4 and β-tubulin loading marker is provided as control.

1