Sirna and Plasmids Human SHP-1 Sirna AGCCUGGAGACUUCGUGCUUU , Control Sirna ACCGUGGACGAUCGGUUCUUU
1
Supplemental Figure Legends
Supplemental Figure 1
Repression of SHP-1 protein expression by endogenous wtp53 activated by Actinomycin D or UV. MCF7, ZR75-1 and MCF7 cells stably expressing p53-siRNA (MCF7 p53 RNAi) were not incubated (-), incubated with 15 nM Actinomycin D (Act D) for 24 h or exposed to 15 kJ UV (UV). Similar amounts of cell lysates were subjected to 8.5% SDS-PAGE, analysed by immunobloting, and when necessary, blot stripping and re-probing for the presence of SHP-1 with rabbit anti-SHP-1 antibodies, p53 with mouse monoclonal PAb-DO1 antibodies (which only recognise human p53), CDC2 with rabbit anti-CDC2 antibodies or actin with rabbit anti-actin antibodies. Results were quantitated by densitometry (this is a representative of 3 experiments).
Supplemental Figure 2
trkA expression in MCF7 and MCF7-trkA cells. Similar amounts of MCF7, and MCF7-trkA cell lysates were immunoprecipitated with anti-trkB3 monoclonal antibody and subjected to 7.5% SDS-PAGE. The presence of trkA was determined by immunobloting with anti-trk203 rabbit polyclonal antibodies (this is a representative of 3 experiments).
Supplemental Figure 3
wtp53 repression of SHP-1 expression does not lead to trkA Y674 and Y675 phosphorylation in the presence of overexpressed wt-SHP-1. MCF7-trkA cells were transiently transfected with pCMV-wt-SHP-1. Cells were a) non-stimulated (-NGF) or b) stimulated with 100 ng/ml NGF for 5 min (+NGF), c) incubated with 15 nM Actinomycin D (Act D) for 24 h, d) incubated with 15 nM Actinomycin D and 100 nM K252a for 24 h or e) incubated with 100 nM K252a for 24 h and stimulated with 100 ng/ml NGF for 5 min. MCF7-trkA-tsp53 were transiently transfected with pCMV-wt-SHP-1 and grown at 320C (32) or 370C (37) for 48 h. Similar amounts of cell lysates were subjected to 7.5% SDS-PAGE, analysed by immunobloting, and when necessary, blot stripping and re-probing for the presence of phosphorylated trkA with rabbit anti-pY674/pY675 antibodies, trkA with rabbit anti-trk203 antibodies, SHP-1 with rabbit anti-SHP-1 antibodies, p53 with PAb-DO1 monoclonal antibodies or actin with rabbit anti-actin antibodies (this is a representative of 4 experiments).
Supplemental Figure 4
p53 repression of SHP-1 expression does not lead to phosphorylation of trkA mutated at Y674 and Y675. MDA-MB-361 cells were transiently transfected with mutant trkA-Y674F/Y675F or wt-trkA. Cells were a) non-stimulated (- NGF) or b) stimulated with 100 ng/ml NGF for 5 min (+ NGF), c) incubated with 15 nM Actinomycin D (Act D) for 24 h, d) incubated with 15 nM Act D and 100 nM K252a for 24 h or e) incubated with 100 nM K252a for 24 h and stimulated with 100 ng/ml NGF for 5min. Similar amounts of cell lysates were subjected to 7.5% SDS-PAGE, analysed by immunobloting, and when necessary, blot stripping and re-probing for the presence of phosphorylated trkA with rabbit anti-pY674/pY675 antibodies, trkA with rabbit anti-trk203 antibodies, SHP-1 with rabbit anti-SHP-1 antibodies, p53 with PAb-DO1 monoclonal antibodies or actin with rabbit anti-actin antibodies. A) MDA-MB-361 cells transiently transfected with mutant trkA-Y674F/Y675F, B) MDA-MB-361 cells transiently transfected with wt-trkA (these are a representative of 4 experiments).
Supplemental Figure 5
A) wtp53 repression of SHP-1 leads to suppression of breast cancer cell proliferation in the presence of endogenous or transfected wt-trkA. Cells were non-transfected (0) or transiently cotransfected with EGFR-siRNA or RISC-Free control siRNA and pCMV-wt-SHP-1 (wt-SHP-1), pLTR-tsp53 (tsp53), SHP-1-siRNA or control-siRNA and pLCNX-KD-trkA (trkA-KD), or transiently transfected with trkA-KD (0) and as stated, and plated in 96 well plates. The next day cells were washed with serum free media and incubated at 320C (32) or 370C (37) in the presence or absence of 100 ng/ml NGF and left to grow for 48 h. MTT assays for proliferation were carried out. Changes in proliferation were calculated by subtracting 48 h cell proliferation by proliferation after initial plating. It is important to indicate that results are presented as proliferation ratios. These were obtained by dividing absorbance values of cells grown in the presence of NGF by values obtained in the absence of NGF. 1) MCF7, 2) ZR75-1, 3) MCF7-trkA-tsp53 and 4) MCF7-trkA (experiments assessed in triplicate).
B) wtp53 repression of SHP-1 expression leads to suppressed breast cancer cell proliferation of MDA-MB-361 cells in the presence of wt-trkA but not mutant trkA-Y674F/Y675F. Cells non-transfected (0) or transiently cotransfected with EGFR-siRNA or RISC-Free control-siRNA and pCMV-wt-SHP-1 (wt-SHP-1), pLTR-tsp53 (tsp53), pMEX-trkA (trkA) and pLCNX-KD-trkA (trkA-KD) or transiently transfected with trkA-KD (0) and as stated, were plated in 96 well plates. Proliferation was analysed as described in Figure 7A.
Supplemental Figure 6
A) wtp53 repression of SHP-1 leads to suppression of breast cancer cell proliferation in the presence of wt-trkA. MCF7, ZR75-1, MCF7-trkA or MCF7-tsp53-trkA cells non-transfected (-) or transiently transfected with pCMV-wt-SHP-1 (wt-SHP-1), pLTR-tsp53 (tsp53), SHP-1-siRNA or control-siRNA were plated in 96 well plates. Otherwise cells were transiently tranfected with pLCNX-KD-trkA (trkA-KD) and as already stated. The next day cells were washed with serum free media and incubated at 320C (32) or 370C (37) in the presence or absence of 100 ng/ml NGF and DMSO or 100 ng/ml NGF and 1 mM AG1478, AG825 or AG1295 and left to grow for 48 h. MTT assays for proliferation were carried out. Changes in proliferation were calculated by subtracting 48 h cell proliferation by proliferation after initial plating. It is important to indicate that results are presented as proliferation ratios. These were calculated by dividing values of cells grown in the presence of NGF by those obtained from cells grown in the absence of NGF. 1 and 2) MCF7 and MCF7 + trkA-KD cells, 3 and 4) ZR75-1 and ZR75-1 + trkA-KD cells, 5 and 6) MCF7-tsp53-trkA and MCF7-tsp53-trkA + trkA-KD cells, 7 and 8) MCF7-trkA and MCF7-trkA + trkA-KD cells, (experiments assessed in triplicate).
B) wtp53 repression of SHP-1 expression and proliferation of MDA-MB-361 cells in the presence of wt-trkA. Non-transfected or transiently cotransfected cells with pCMV-wt-SHP-1 (wt-SHP-1), pLTR-tsp53 (tsp53) or pMEX-trkA (trkA) were plated in 96 well plates. Otherwise cells were transiently transfected or cotransfected with pLCNX-KD-trkA (trkA-KD) and as already stated. The next day cells were washed with serum free media and incubated at 320C (32) or 370C (37) in the presence or absence of DMSO and 100 ng/ml NGF or 100 ng/ml NGF and 1 mM AG1478, AG825 or AG1295 left to grow for 48 h. MTT assays to measure proliferation were carried out. Changes in proliferation were calculated by subtracting 48 h cell proliferation by cell proliferation after initial plating. It is important to indicate that results are presented as proliferation ratios. These were calculated by dividing values of cells grown in the presence of NGF by those obtained from cells grown in the absence of NGF. 1) MDA-MB-361 cells transiently transfected with wt-trkA, or transiently cotransfected with wt-trkA and tsp53 or wt-trkA, tsp53 and wt-SHP-1. 2) MDA-MB-361 cells transiently cotransfected with trkA-KD and wt-trkA, trkA-KD, wt-trkA and tsp53 or trkA-KD, wt-trkA, tsp53 and wt-SHP-1 (experiments assessed in triplicate).
Supplemental Figure 7
Repression of SHP-1 expression by wtp53 leads to cell cycle arrest of breast cancer cells in the presence of wt-trkA. Cells were plated in 3 cm plates containing collagen coated cover slips. The next day were non-transfected or transiently transfected with pCMV-wt-SHP-1 (wt-SHP-1), pLTR-tsp53 (tsp53), SHP-1-siRNA or control-siRNA and incubated for 48 h at 320C (32) or 370C (37) in the presence or absence of 1 mM AG1478, AG825 or AG1295. Otherwise cells were transiently cotransfected with pLCNX-KD-trkA (trkA-KD) and as previously stated, and incubated in the presence or absence of 1 mM AG1478, AG825 or AG1295. Then were incubated with Brdu for 4 h and stained with anti-Brdu antibodies followed by Alexa 568 conjugated secondary antibodies. Mounted cover slips were analysed by fluorescence microscopy and cells with incorporated Brdu were counted in fields (chosen at random) containing 60-70 cells. Results are the mean of triplicate experiments and their standard deviation. A and B) MCF7 cells non-transfected or transiently transfected with trkA-KD with or without (-) tsp53, SHP-1-siRNA or control-siRNA, or transiently cotransfected with tsp53 and wt-SHP-1, C and D) ZR75-1 cells non-transfected or transiently transfected with trkA-KD with or without (-) tsp53, SHP-1-siRNA or control-siRNA, or transiently cotransfected with tsp53 and wt-SHP-1; E and F) MCF7-tsp53-trkA and MCF7-trkA cells, non-transfected or transiently transfected with trkA-KD with or without (-) wt-SHP-1, SHP-1-siRNA or control-siRNA (experiments assessed in triplicate).
Supplemental Figure 8
A) SHP-1 and p53 do not associate. Similar amounts of lysates from NIH3T3 cells stably transfected with tsp53 (NIH3T3-tsp53), NIH3T3, p53-/- and Saos2 cells were immunoprecipitated with anti-p53 PAb248 or PAb421 or rabbit anti-SHP-1 antibodies, subjected to 7.5% SDS-PAGE, analysed by immunobloting for the presence of SHP-1 with rabbit anti-SHP-1 antibodies, p53 with sheep anti-p53 antibodies (these are a representative of three experiments).
B) SHP-1 and p53 do not associate in the presence of trkA. Similar amounts of lysates from NIH3T3 cells stably transfected with wt-trkA NIH3T3, p53-/- and Saos2 cells were immunoprecipitated with anti-p53 PAb248, rabbit anti-SHP-1 antibodies or anti-trkB3 antibodies, subjected to 7.5% SDS-PAGE, analysed by immunobloting for the presence of trkA with rabbit anti-trk203 antibodies, SHP-1 with rabbit anti-SHP-1 antibodies, p53 with sheep anti-p53 antibodies (this is a representative of three experiments).
Supplementary Information
Materials and Methods
siRNA and Plasmids
Human SHP-1 siRNA “AGCCUGGAGACUUCGUGCUUU”, control siRNA “ACCGUGGACGAUCGGUUCUUU” oligonucleotides, SMARTpool human EGFR-siRNA 4 and RISC-Free siRNA were obtained from Dharmacon RNA Technologies. For eukaryotic expression, a dominant negative -SHP-1 containing a deletion at amino acid position 451-475 and wt-SHP-1 cloned in pGEX-2T--SHP-1 and pGEX-2T-wt-SHP-1 respectively (given by B. Neel and D. Kaplan) were cut with Eco RI and the 2.1kb fragment ligated into Eco RI cut pCDNA3.1. To clone SHP-1-P1, genomic DNA from MCF7 cells was extracted using the GenElute mammalian genomic DNA kit (Sigma). The 469 bp region containing SHP-1-P1 was cloned by PCR amplification and mutants produced . The 469 bp region containing SHP-1-P1 was amplified by PCR using a forward p469 5’ ctcgagaggttgagaggctggagtgg 3’ primer and p +1 5’ agcttcaagccaggtgaggaagaaccg c 3’ reverse primer. Products were cut with Xho I and HinD III and ligated into Xho I and HinD III cut pGL2 (Promega) to obtain a luciferase expressing vector. To produce nested deletion mutants of SHP-1-P1, PCR was carried out with the following forward primers: p343 - 5’ggtaccaggtttcccccattggttgctcttcctca 3’, p315 - 5’ ggtaccagccagggttacttcctggtctgttcccc 3’, p282 - 5’ ggtacccaatacccc gccgctctgtcagcttgagc 3’, and p96 - 5’ ggtacctattagtccagggtttgtccc tgcagtgc 3’, and the reverse primer p +1. Products were cut with Kpn I and Hind III and ligated into Kpn I and Hind III cut pGL2 (Promega). Mutants at positions -410 and -240 were produced by re-ligating Kpn I or Sac I cut pGL2-SHP-1-P1-lu. To make the D-CCAAT mutant, a forward pD-CCAAT 5’ gtacctccttctctgaggaactgggctgttagg g 3’ primer and a reverse pD-CCAAT-R 5’ gaagtaaccctggctgaggaagagcaaatcctgggggaaacct 3’ primer containing mutated D-CCAAT sequences were used for PCR with SHP-1-P1 cloned in pBluescript as a template, the PCR product was cut with EcoNI and Kpn I and subsequently ligated into Kpn I and EcoNI cut pGL2-SHP-1-P1-lu. To produce the P-CCAAT mutant a forward primer pP-CCAAT 5’ gggtttcct ggagactattagtccagggtttgtccctgcaggtacaccagcc 3’ containing mutated P-CCAAT sequences and the p +1 reverse primer were used for PCR with SHP-1-P1 cloned in pBluescript as a template. The PCR fragment was cut with Pfo I and Hind III and then ligated to Pfo I and Hind III cut pGL2-SHP-1-P1-lu plasmid. All contructs were sequenced for verification.
Cell culture and transfections
MCF7, T47D, MDA-MB-231 and MDA-MB-361, breast carcinoma cell lines and Saos2 osteosarcoma cells were maintained in Dulbecco’s Modified Eagle’s medium. MDA-MB-157, ZR75-1, MCF7-p53DD and MCF7 siRNAp53 cells were maintained in RPMI medium. Cultures were supplemented with 10%fetal calf serum, 2mM glutamine, 1mM sodium pyruvate, and 100IU/ml penicillin/streptomycin (Invitrogen). When indicated cells were incubated with Cisplatin (Sigma), Actinomycin D (Sigma), K252a, AG1478, AG825, AG1295 (Calbiochem) or UV irradiated using a Stratagene crosslinker.
MCF7 cells were cotransfected with pMEX-trkA (which codes for human wt-trkA), and pSV2neo or MCF7 cells expressing exogenous trkA, were cotransfected with pLTR-tsp53 (tsp53 val-135) and pHygro using Lipofectin (Invitrogen). 1x105 cells were plated in 10 cm plates and incubated overnight at 370C. Cells were washed with serum free medium and DNA lipofectin mix (10l/15l) was added to cells in 3ml of serum free medium and left to incubate for 5 hr at 370C, then were washed and incubated for 48hr in serum supplemented medium. Colonies were selected in 600 mg/ml G418 or 50 mg/ml Hygromycin B containing medium. Resistant colonies were obtained and screened for trkA and/or tsp53 expression by immunoprecipitation. Cell lines were passaged in 5 mg/ml Hygromycin B or 50 mg/ml G418 containing medium.
RT-PCR
Oligonucleotide primers for RT-PCR were human GAPDH as of [Thornborrow et al., 2002], forward and reverse murine GAPDH 5’ACCCAGAAGACTGTGGATGG 3’/5’ CACATTGGGGGTAGGAACAC 3’, human SHP-1 as of [Tidow et al., 1999], forward and reverse murine SHP-1 5’ AACCAGCTGCTAGGTCCAGATG 3’ / 5’CTGCTGTGTCATGCTCCCTACT 3’, human p21 as of [Krause et al., 2001], forward and reverse murine p21 5’ GGGATGGCAGTTAGGACTCAAC 3’/5’ GTGGGGCAAGTGCCTAGATATG 3’, human CDC25 as of [Krause et al., 2001], forward and reverse murine CDC25 5’ CTCCCTCGGTGAAGACTCTGAAG 3’/5’CGAAAGGTCAAGGCAACATTTTG 3’.
Chromatin Immunoprepipitation assay
Cold swelling buffer (10Mm Hepes (KOH pH 7.9), 1.5 mM MgCl2, 10mM KCl), lysis buffer (50mM Tris pH 8.1, 10mM EDTA, 1% SDS), dialysis buffer (50 mM Tris pH 8.0, 2 mM EDTA), wash buffer (100 mM Tris pH 9.0, 500mM LiCl, 1 % NP40, 1 % Deoxycholic acid), and elution buffer (50 mM NaHCO3, 1 % SDS).
PCR amplification was undertaken using oligonucleotide primers for BACE as described in [Spiesbach et al., 2005] and cyclin B2 as described in [Wasner et al., 2003]. For SHP-1-P1 amplification p282 forward and p+1 reverse primers were used.
Antibodies
Rabbit anti-trk 203 and sheep anti-p53 (given by David Kaplan and Alison Spark respectively). Anti-NF-YA and anti-EGFR Ab-1 mouse monoclonal antibodies (given by R. Mantovani and Cancer Research UK central antibody resource). Rabbit anti-SHP-1, rabbit anti-CDC2 and anti-trkB3 (Santa Cruz Biotechnologies). Sheep anti-EGFR (Upstate Biotechnologies), rabbit anti-trkA pY674/pY675 and rabbit anti-actin (Sigma). Rabbit anti-NF-YB Diagenode) and rat anti-Brdu (Serotec). Anti-phosphotyrosine 4G10, PAb DO1, PAb 248 mouse monoclonal antibodies.
Immunoprecipitation and Western blotting
Cells were lysed in ice cold 20mM Tris-HCl pH 8, 137mM NaCl, 10% glycerol, 1mM phenylmethylsulfonyl fluoride, 0.15 U/ml Aprotinin, 20 mM Leupeptin, 1 mM Na3VO4 and 1 % NP-40 (lysis buffer). Protein concentration was determined using the BioRad protein assay. Lysates with similar protein concentration were boiled in sample buffer (10 % glycerol, 2 % SDS, 0.1mM dithiothreitol and 0.001 % bromophenol blue). Samples were run on 8.5 or 7.5 % SDS-PAGE gels. For immunoprecipitations after lysate incubation with anti-p53 PAb-DO-1, PAb248 or anti-trkB3 monoclonal antibodies for 2 h at 40C precipitates were collected with 20 l of protein G sepharose for 1 h at 40C and washed with cold lysis buffer, then pellets were boiled in sample buffer and samples run on 7.5 or 8.5 % SDS-PAGE gels. For immunoprecipitation of EGFR the protocol described in [Buday and Downward, 1993] was followed. Cells were starved for 24h with media containing 0.2% calf serum and for 3 h with media containing 1 mg/ml BSA. Then cells were subjected to 100mM Na3VO4 treatment for 30 min and stimulated or not stimulated with 100ng/ml of EGF for 10min, washed with cold PBS containing 1mM Na3VO4, and lysed in ice cold lysis buffer (30mM Hepes pH 7.5, 100mM NaCl, 1% Triton X-100, 1mM EGTA, 1mg/ml BSA, phosphatase inhibitors (1mM Na3VO4, 2mM para-nitrophenylphosphate, 10mM NaF and 25mM phenyl arsine oxide) and EDTA free protease inhibitors (Roche Diagnostics). Lysates with similar protein concentration were immunprecipitated with anti-EGFR Ab-1 monoclonal antibodies for 2 h at 40C precipitates were collected with 20 l of protein G sepharose for 1h at 40C and washed with cold PBS containing 0.1% Triton X-100 and 1mM Na3VO4, then pellets were boiled in sample buffer and samples run on 7.5 % SDS-PAGE gels.
The resolved proteins were transferred onto nitrocellulose. Blots were blocked for 1h in 137mM NaCl and 20mM Tris-HCl pH 8 (TBS) containing 2 % bovine serum albumin (BSA); and incubated with the desired antibodies diluted in TBS containing 0.2 % Tween 20 (TBS-T) at 4oC overnight. Blots were washed three times with TBS-T for 5min at room temperature, and incubated with horseraddish peroxidase conjugated rabbit anti-mouse, swine anti-rabbit or rabbit anti-sheep antibodies (DAKO) for 1h at room temperature, washed three times with TBS-T and proteins were visualised by chemoluminescence (ECL Pharmacia/Amersham). When necessary blots were stripped of antibody by incubating in 25 % SDS, 100mM -mercaptoethanol, 62.5mM Tris-HCl pH 6.8 for 1hr at 650C or 700C, rinsing three times with TBS for 15min and reprobing with the desired antibody.
Supplemental References
Buday L, Downward J. (1993). Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell. 73: 611-620.
Fraser SP, Salvador V, Manning EA, Mizal J, Altun S, Raza M, Berridge RJ, Djamgoz MB (2003) Contribution of functional voltage-gated Na+ channel expression to cell behaviors involved in the metastatic cascade in rat prostate cancer: I. Lateral motility. J Cell Physiol. 195: 479-87
Krause K, Haugwitz U, Wasner M, Wiedmann M, Mössner J, Engeland K. (2001). Expression of the cell cycle phosphatase cdc25C is down-regulated by the tumor suppressor protein p53 but not by p73. Biochem Biophys Res Commun. 284: 743-750.
Tidow N, Kasper B, Welte K. (1999). SH2-containing protein tyrosine phosphatases SHP-1 and SHP-2 are dramatically increased at the protein level in neutrophils from patients with severe congenital neutropenia (Kostmann's syndrome). Exp Hematol. 27: 1038-1045.
Thornborrow EC, Patel S, Mastropietro AE, Schwartzfarb EM, Manfredi JJ. (2002). A conserved intronic response element mediates direct p53-dependent transcriptional activation of both the human and murine bax genes. Oncogene. 7: 21990-21999.
Wasner M, Haugwitz U, Reinhard W, Tschöp K, Spiesbach K, Lorenz J, Mössner J, Engeland K. (2003). Three CCAAT-boxes and a single cell cycle genes homology region (CHR) are the major regulating sites for transcription from the human cyclin B2 promoter. Gene. 312: 225-237.