Supplemental Information
SI-Table 1: Selection and culture of murine MAPC
Cell population / Culture condition / Cell expansion / Phenotype* / Tri-lineage differentiation / Oct-4CD45-Ter119- fresh cells / No LIF
N=3 / FN/EGF/PDGF / None / ND / ND / ND
BMMNC depleted week 3-4 of CD45+Ter119+ cells / No LIF
N=2 / FN/EGF/PDGF / 6-8 weeks / ND / ND / ND
N=2 / Laminin/EGF/PDGF / 6-8 weeks / ND / ND / ND
N=2 / Collagen/EGF/PDGF / 6-8 weeks / ND / ND / ND
N=2 / Matrigel/EGF/PDGF / 6-8 weeks / ND / ND / ND
BMMNC depleted week 3-4 of CD45+Ter119+ cells / + LIF
C67BL/6: N=3
ROSA26: N=3 / FN/EGF/PDGF/LIF / >120PDs / CD44, MHC-I negative / yes / yes
C67BL/6: N=2 / Laminin/EGF/PDGF / Stopped after 30PDs / CD44, MHC-I positive / ND / ND
C67BL/6: N=2 / Collagen/EGF/PDGF / Stopped after 30PDs / CD44, MHC-I positive / ND / ND
C67BL/6: N=2 / Matrigel/EGF/PDGF / Stopped after 30PDs / CD44, MHC-I positive
C67BL/6: N=2 / FN/EGF/PDGF/LIF
+10% FCS / Stopped after 30PDs / CD44, MHC-I positive / No / No
C67BL/6: N=2 / FN/EGF/PDGF/LIF
Density >2x103/cm4 / Stopped after 30PDs / CD44, MHC-I positive / No / No
*: See also SI-Fig.1
ND: Not done
Legend:
We have recently demonstrated that human post-natal bone BM contains primitive progenitors that co-purify with mesenchymal stem cells, we have termed multipotent adult progenitor cells, or MAPC. Human MAPC cultures were developed by testing multiple conditions, including culture of BMMNC on fibronectin (FN), collagen-type-IV or laminin. Media conditions tested included several concentrations of fetal calf serum (FCS), epidermal growth factor (EGF), platelet derived growth factor (PDGF)-BB, acidic fibroblast growth factor (aFGF), basic (b)FGF, bone morphogenetic protein (BMP)4, insulin-like growth factor (IGF)1, and dexamethasone. Only when human CD45 and GlyA depleted human BM mononuclear cells (MNC) were cultured with 0-2% FCS and 10 ng/mL EGF and 10 ng/mL PDGF-BB did we see growth of MAPC, that can be cultured without senescence and differentiate into mesenchymal cells, endothelial cells and hepatocyte like cells1-3 .
To isolate and culture expand MAPC from murine BM, we initially used methods identical to those used for human MAPC. BMMNC from C57BL/6 (n=2; age 8 weeks) were depleted of CD45 and TER119 positive cells using micromagnetic beads (Miltenyi Biotec, Sunnyvale, CA) yielding <0.1% of BMMNC. CD45-TER119- cells were plated in medium consisting of 60% DMEM-LG (Gibco-BRL, Grand Island, NY), 40% MCDB-201 (Sigma Chemical Co, St. Louis, MO), with 1X insulin-transferrin-selenium (ITS), 1X lenolenic-acid-bovine-serum-albumin (LA-BSA), 10-9M dexamethasone (Sigma) and 10–4M ascorbic acid 2-phosphate (Sigma), 100U penicillin and 1000U streptomycin (Gibco) on fibronectin (FN) (Sigma) with 2% fetal calf serum (FCS) (Hyclone Laboratories, Logan, UT) and with epidermal growth factor (EGF) and platelet derived growth factor (PDGF)-BB (both from R&D Systems, Minneapolis, MN). However, no MAPC could be grown under these conditions.
We next tested whether we could culture mouse MAPC by initially plating BMMNC and depleting hematopoietic cells ~3 weeks after initiation of the cultures. BM was obtained from C57BL/6 animals (n=2, age 8 weeks). 105 BMMNC / cm2 were plated with 1-25 ng/mL EGF and 1-25 ng/mL PDGF-BB in FN, laminin, collagen type IV or matrigel (all from Sigma) coated culture vessels. More than 80% of cells, presumed hematopoietic cells, died during the first week. Cells were maintained between 2 and 5x103 cells/cm2. After ~3 weeks, CD45-/Ter119- cells were selected (~20% of all cells) and subcultured at 10 cells / well. Cells were maintained between 0.5 and 1.5x103 cells/cm2 by sub-culturing every 2-3 days at a 1:2 dilution. However, no long-term cell expansion was seen.
Because murine ES cells are dependent on leukemia inhibitory factor (LIF)4, and we had shown that human MAPC express mRNA for the LIF-receptor, we next tested whether addition of LIF would better support cell growth. BM was obtained from 3 C57BL/6 mice or 3 ROSA26 mice (age 6-8 weeks) and BMMNC were plated on FN, laminin, collagen type IV and matrigel in expansion medium with 1-25 ng/mL each EGF, PDGF-BB and LIF (R&D Systems). After ~3 weeks, remaining CD45-/Ter119- cells were selected (~20% of all cells), cells subcultured at 10 cells/well, and maintained between 0.5-1.5x103 cells/cm2. MAPC cultured on FN with 10 ng/mL EGF, 10 ng/mL PDGF-BB and 10 ng/mL LIF were CD3, Gr-1, Mac-1, CD19, CD34, CD44, CD45, cKit, and major histocompatibility (MHC) class-I and class-II negative; expressed low levels of Flk1 and Sca1, and higher levels of CD13 and SSEA-15 (Fig.1) The MHC-class-I and CD44 negative phenotype of mMAPC is similar to what we have shown for hMAPC1. Approximately 1% of wells seeded with 10 CD45-/TER119- cells yielded continuous growing cultures.
Culture of CD45-/TER119- cells on FN with cytokine concentrations <5ng/mL did not yield continuous growing cultures. Culture of CD45-/Ter119- cells with 25ng/mL EGF or PDGF did not improve growth of cells. Although cell expansion during the initial 2-3 months was greater when cells were cultured on matrigel, laminin or collagen type IV, cells had phenotypic characteristics of MSC: CD44 and MHC class-I positive6. (See also SI-Fig.1).
When cells were cultured with >2%FCS, they became larger, expressed CD44 and MHC-class I antigens, and could not be induced to differentiate to endothelium or neuroectodermal or endodermal cell types. Likewise, when cells were maintained at higher cell densities (i.e. >2x103 cells/cm2), they became larger, expressed CD44 and MHC-class I and could not differentiate to endothelium, neuroectoderm or endoderm.
To evaluate Oct-4 and rex-1 expression, RNA was extracted from mouse MAPC (PD 75) and ES cells. mRNA was reverse transcribed and cDNA underwent 40 rounds of amplification (ABI PRISM 7700, Perkin Elmer Applied Biosystems) with the following reaction conditions: 40 cycles of a two-step PCR (95oC for 15 sec., 60oC for 60 sec.) after initial denaturation (95oC for 10 min.) with 2ml of DNA solution, 1X TaqMan SYBR Green Universal Mix PCR reaction buffer. Primers for Oct-4: 5’-GAAGCGTTTCTCCCTGGATT-3’ and 5’-GTGTAGGATTGGGTGCGTT-3’; for Rex-1: 5’-GAAGCGTTCTCCCTGGAATTTC-3’ and 5’-GTGTAGGATTGGGTGCGTTT-3’. mRNA levels in mMAPC were normalized using b-actin, and compared with levels in mouse ES cells. Products were visualized by electrophoretic separation on 1% agarose gels and ethidium bromide staining.
References:
1. Reyes, M. et al. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 98, 2615-25 (2001).
2. Reyes, M. et al. Origin of endothelial progenitors in human post-natal bone marrow. J Clin Invest 109:337-46 (2002).
3. Schwartz, R. E. et al. Multipotent Adult Progenitor Cells from Bone Marrow Differentiate into Functional Hepatocyte-like Cells. J Clin Invest In Press (2002).
4. Williams, R. L. et al. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684-7 (1988).
5. Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-7 (1998).
6. Pittenger, M. F. et al. Multilineage potential of adult human mesenchymal stem cells. Science 284, 143-147 (1999).
SI-Table 2: Single cell origin analysis:
The murine stem cell virus-enhanced green fluorescent protein (MSCV-eGFP) retroviral plasmid (gift from Dr. Pear, U. of Pennsylvania)1 was co-transfected with the pCL-Ampho packaging plasmid in 293 cells (gift from Dr. Haas, U. of California, San Diego)2. Retroviral supernatants were collected in MAPC medium. Mouse or rat BMMNC transduced with MSCV-eGFP were subcultured at 10 cells/well, eGFP+ cells populations culture expanded for > 100PDs. RMAPC were subcultured after 75PDs at 100 cells/well and expanded for 20PDs. In addition rMAPC and mMAPC were induced to differentiate to endothelium, neuroectoderm and endoderm (Fig.3 and SI-Fig.3).
Flanking Region Splinkerette PCR: DNA from 106 mMAPC or rMAPC was prepared from cells by standard methods. 300 ng genomic DNA was digested with AscI, which cuts only once in the MSCV-eGFP provirus, and a splinkerette linker was ligated to the 5’ end 3. The two oligonucleotides used for the splinkerette linker were as follows: aatttagcggccgcttgaatttttttttgcaaaaa (the hairpin loop forming sequence is in lower case and the upper case is the reverse complement of the second splinkerette oligo), and agtgtgagtcacagtagtctcgcgttcgaattaagcggccgcta, (the underlined sequence is also the sequence of the linker-specific primer (LS Primer) used for the PCR and RT steps). We used a 5’-biotin-T7 coupled primer that recognizes a sequence in the eGFP gene (Biotin-ggccagtgaattgtaatacgactcactataggctggcacatggtcctgctg gag ttcgtga; under-lined portion shows the minimum promoter sequence needed for efficient in vitro transcription and the upper case is the eGFP specific sequence) and LS primer to amplify the flanking regions for 10 rounds using Advantage 2 polymerase (Clontech Laboratories, Palo Alto, CA, USA). The biotin labeled amplified product was captured using streptavidin-magnetic beads (Streptavidin Magnetic Particles; Roche) and further amplified using the T7 RNA polymerase, approximately 1,000 fold, and then DNAase 1 treated. The product was reversed transcribed using the LS primer according to the superscript II protocol (Gibco-BRL, Grand Island, NY), and subsequently amplified by 30 rounds of nested PCR using the primer for the 3’LTR. The flanking DNA in the host genome was sequenced. The sensitivity of this technique is 1 target molecule in a cell population of 5,000 cells1.
Confirmation by Flanking Region Specific PCR: Specific primers were generated to amplify the genomic sequence between the 3’ MSCV-LTR and the host-flanking genome. Quantitative PCR was used to quantify the relative amount of flanking sequence compared with the eGFP sequence. Flanking sequences and primers are shown in Table below.
Clone / Genomic sequenceRat flanking sequence
/ gatccttgggagggtctcctcagattgattgactgcccacctcgggggtctttcaaagtaactccaaaagaagaatgggttgttagttattaaacggttcttagtaaagttttggttttgggaatcacagtaacaactcacatcacaactccaatcgttccgtgaaamatch in mouse genomic database = G10P608574FH4
Mouse flanking sequence / gatccttgggagggtctcctcagattgattgactgcccataagttataagctggcatgactgtgttgctaaggacactggtgaaagc
match in rat genomic database = TUWEP1E43505A
Bold: MSCV LTR
Bold and underlined: MSCV LTR primer used for Q-PC
Italics and underlined: Flanking sequence primers used for Q-PCR
1. Pear, W. S. et al. Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood 92, 3780-92 (1998).
2. Norris, P., Jepsen, K. & Haas, M. High-titer MSCV-based retrovirus generated in the pCL acute virus packaging system confers sustained gene expression in vivo. J Virol Methods 75, 161-167 (1998)
3. Lenvik, T., Lund, T. C. & Verfaillie, C. M. Blockerette-ligated catpture T7 amplified RT-PCR, a new method for determining flanking sequences. Molecular Therapy In Press (2002).
SI-Table 3: Q-RT-PCR Otx1, Otx2, Pax2, Pax5 and nestin
5’-ATGGCTCTGGCACTGATACGGATG-3’
otx22 / 5’-CCATGACCTATACTCAGGCTTCAGG-3’;
5’-GAAGCTCCATATCCCTGGGTGGAAAG-3’
Nestin2 / 5’-GGAGTGTCGCTTAGAGGTGC-3’;
5’-TCCAGAAAGCCAAGAGAAGC-3’
Pax22 / 5'-CCAAAGTGGTGGACAAGATTGCC-3',
5'-GGGATAGGAAGGACGCTCAAAGAC-3'
Pax52 / 5’-CAGATGTAGTCCGCCAAAGGATAG-3’,
5’-ATGCCACTGATGGAGTATGAGGAGCC-3’
RNA was extracted from mMAPC and neuroectodermal differentiated progeny (day 1- 7 after addition of bFGF), or mouse brain as described1. mRNA was reverse transcribed and cDNA underwent 40 rounds of amplification by Q-PCR amplification as for NEO-Q-PCR. mRNA levels were normalized using GAPDH as housekeeping gene, and compared with levels mouse brain tissue (nestin, Otx1, Otx2, Pax2, Pax5).
1. Reyes, M. et al. Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood 98, 2615-2625. (2001).
2. Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M. & McKay, R. D. Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat Biotechnol 18, 675-679 (2000).
SI-Table 4: Hematopoietic engraftment in NOD/SCID mice transplanted with 106 ROSA26 MAPC
% of total
#1 / 4 / N / 2 / 38 / 27 / 18 / 11
#5 / 24 / N / 3 / 62/70* / 9/6* / 26/7* / 5/9*
#7 / 8 / Y / 10 / 47/60* / 18/24* / 20/10* / 9/10*
#10 / 10 / Y / 5 / 56 / 12 / 31 / 4
Legend: 106 ROSA26 MAPC were injected via tail vein into 6-8-week old NOD/SCID mice with or without 250cGy irradiation. Animals were sacrificed 4-24 weeks after MAPC infusion. 0.5-1 ml of blood was obtained when animals were sacrificed and BM was collected by flushing femurs and tibias. For phenotyping, red cells in blood and BM were depleted using ice cold ammonium chloride and 105 cells used for cytospin centrifugation. Slides were stained with anti-b-gal-FITC Ab and PE-conjugated Abs to CD45, CD19, Mac-1, GR-1 and TER119. Slides were examined under fluorescence microscope and the number of PE-positive cells per 100 b-Gal positive and per 100 b-Gal negative cells counted.
* x/y: x=percent b-gal positive cells (donor cells) expressing the marker of interest
y=percent b-gal negative cells (host cells) expressing the marker of interest
SUPPLEMENTAL INFORMATION FIGURES
SI-Figure 1: Morphology and FACS phenotype of MAPC
Mouse BMMNC were plated for 3-4 weeks on FN, collagen, laminin matrigel with 10 ng/mL EGF, PDGF-BB and LIF. CD45 and TER119 cells were depleted and CD45-TER119- cells plated at 10 cells / well on the same ECM components and with the same cytokines. Cells were sub-cultured every 36-48h to keep cell densities between 500 and 1,500/cm2.
Panel a: Light microscopy of MAPC after 55 population doublings
Panel b: MAPC cultured on fibronectin for 30PDs or 120PDs or on matrigel, collagen or laminin for 30PDs were collected by trypsinization and stained with FITC- or PE-coupled Abs against CD44, CD45, MHC class-I or IgG isotype control Abs. Cells were analyzed using FACS-Calibur.
SI-Figure 2: rMAPC expansion and telomere length
BM was obtained from Sprague Dawley rats. Rat BMMNC were plated for 3-4 weeks on FN, with 10 ng/mL EGF, PDGF-BB and LIF. CD45 and Ter119 cells were depleted and CD45-Ter119- cells plated at 10 cells / well on the same ECM components and with the same cytokines. Cells were sub-cultured every 36-48h to keep cell densities between 500 and 1,500/cm2. (See SI-Table 1 for further description of method).
Panel a: Cells were enumerated at each passage under hemocytometer.
Panel b: rMAPC that had undergone 40 to 100PDs were harvested and telomere length evaluated (using methods previously described28). rMAPC after 42 PDs (lane 1), 75 PDs (lane 2), 86 PDs (lane 3) and 100 PDs (lane 4).
SI-Figure 3. In vitro differentiation of rMAPC to endothelium, neuroectoderm and endoderm
Clonal eGFP+ rMAPC were induced to differentiate to endothelium, neuroectoderm and endoderm as described. After 14 days, cells were fixed, stained with Abs against lineage specific antigens and examined by confocal microscopy.