SUPPLEMENTARY DATA

Sequencing protocols for the genomic regions of interest

We designed specific PCR amplification protocols for all the genomic regions of interest under standard conditions in a final volume of 20 μl with 20 ng of genomic DNA, 20 nmoles of dNTPs (Ecogen), 2 μl PCR Buffer 10X (Roche Diagnostics), 10 pmoles of each amplification primer and 2 UI Taq DNA polymerase (Roche Diagnostics). Supplementary table 1 shows the nucleotide sequences of the amplification primers and the annealing temperatures for each PCR reaction. PCR products were purified by using the Nucleospin Extract kit (Macherey-Nagel) and bi-directionally sequenced using the corresponding pair of amplification primers. Sequencing reactions were performed using the CEQ Dye Terminator Cycle Sequencing Quick Start Kit (Beckman Coulter, Inc) according to the manufacture’s instructions. Fluorograms were analyzed on CEQTM 8000 Genetic Analysis System following the manufacturer’s instructions (Beckman Coulter, Inc).

Supplementary table 1. Amplification primers and annealing temperatures for the polymorphisms analysed in this study.

Polymorphisms / Amplification primers (5´→3´) / Fragment size (bp) / Annealing temperature
rs3798573 / F: CGCAGTCGTGACTTAAAATGT
R: TCACAGATGCTTATGAATGCC / 469 / 60 ºC
rs9397483, rs3778087, rs3778088 and rs3778089 / F: GGAGGGTTGATTTGTTGTGA
R: TTTCTGTTGCAGAGAATCTGG / 289 / 58 ºC
ESR1 deletion* / F: CGCAGTGCTGACTTAAAATGT
R: TTTACCATCAGATCATGAGGTC / 3,343 / 60 ºC

F: Forward primer; R: Reverse primer. *This specific protocol allowed us to determine the exact breakpoints of the ESR1-NCD1 deletion.

Genotyping protocol for rs3020375 marker

We designed an alternative genotyping protocol to those presented in our previous study for rs3020275 (reference number 3 of the manuscript). This alternative protocol is based on PyrosequencingTM technology (Biotage AB, Uppsala, Sweden) and comprises a PCR amplification step carried out in a in final volume of 20 μl containing 20 ng of genomic DNA, 1.25 mM Cl2Mg, 62.5 μM deoxynucleotides triphosphates, 50 pmol of each amplification primer, and 2 UI Taq DNA polymerase (Roche Diagnostics, Basel, Switzerland). Amplification and sequencing primers along with annealing temperatures are indicated in Supplementary table 2.

Supplementary table 2: Amplification and sequencing primers and annealing temperature for rs3020375 genotyping protocol.

Amplification and sequencing
primers (5´→3´) / Fragment size (bp) / Annealing temperature
F: B-TGAAAACTACTGGCATCGAC
R: TGCTGTTTGGTGTACTGGTC
S: GCACAGTTCCAAGCAT / 374 / 60 ºC

F: Forward amplification primer; R: Reverse amplification primer; S: Sequencing primer; B: Biotine.

Genotyping protocols for ESR1 gene deletion

We developed three alternative high-throughput genotyping protocols for the ESR1 gene deletion. These protocols are based in three different technologies (capillary electrophoresis, Pyrosequencing and Fluorescense Resonance Energy Transfer).

The protocols share an initial PCR step. The PCR amplification is carried out by using one forward primer ED-F: 5´-TGAAAACTACTGGCATCGAC-3´ and two reverse primers ED-RW: 5´-GTCTCTGCAGCACTCAATAC-3´ and ED-RM: 5´- TTTACCATCAGATCATGAGGTC-3´. ED-F and ED-RM primers binds to their complementary genomic segments located 104 and 93 bp from the deletion 5´ and 3´ ends respectively. ED-RW primer anneals with its complementary segment, within the genomic region affected by the deletion, 116 bp from the 5´ end of the deletion. The application of this PCR protocol in genomic DNA samples without the ESR1 deletion (wild type samples) results in a single amplification product (260 bp) delimited by ED-F and ED-RW primers. In wild type samples, the PCR product resulting from the ED-F and ED-RM amplification primers combination is not obtained under those PCR conditions given its size (2493 bp). From genomic DNA samples with one (heterozygous) or two (homozygous) deleted alleles present both PCR products (260 and 239 bp) and the 239 bp products are obtained respectively.

PCR is carried out in a final volume of 20 ul containing 40 ng of genomic DNA, 1.23 mM MgCl2, 62.5 uM deoxynucleotides triphosphate, 50 pmol of each amplification primer and 2 IU Taq DNA polymerase. Cycling conditions are: an initial denaturing step at 94 ºC for 5 min., 35 cycles of 95ºC for 30 sec., 62 ºC for 30 sec. and 72 ºC for 30 sec. A final elongation step at 72 ºC for 7 min is also performed. Once PCR products are obtained, they can be subjected to alternative genotyping protocols:

Capillary electrophoresis:

ED-F primer is labelled in its 5´ end with a fluorochrome, for instance Cy5, to detect PCR products after their separation by capillary electrophoresis. 5 ul of a 1:20 dilution of the PCR product is mixed with 0.25 ul of CEQ DNA Size Standard-600 (Beckman Coulter, Inc., Fullerton, CA, USA), the mixture is diluted in 20 ul of GenomeLab DNA Size Standard Kit – 600 ((Beckman Coulter, Inc., Fullerton, CA, USA) and this dilution is loaded onto the automatic sequencer CEQ 8000 Genetic Analysis System (Beckman Coulter, Inc., Fullerton, CA, USA). Capillary electrophoresis is carried out at 8 KV and 50 ºC during 35 min. Raw data analyses are performed by using the Fragment Analysis module of the Genetic Analysis System software (Beckman Coulter, Inc., Fullerton, CA, USA) according to manufacturer´s instructions. Supplementary figure 1 shows representative plots resulting from the application of this protocol.

PyrosequencingTM (Biotage AB, Uppsala, Sweden):

To use this protocol, ED-RW and ED-RM amplification primers are labelled in their 5´end with biotine. We have designed a sequencing primer ED-S: 5´-ACT GTGCCAGGCACTGC-3´ and a dispensation order (GCTCGTC) to easily differentiate both PCR products by the profile of the Pyrograms. With this protocol a real time sequencing of the deletion breakpoints is peformed. This protocols is performed in a PSQ 96 Pyrosequencing instrument (Biotage AB, Uppsala, Sweden) by using the Pyro Gold Reagents kit (Biotage AB, Uppsala, Sweden) according to the manufacturer´s instructions. Supplementary figure 2 shows representative plots derived from the application of this protocol.

Fluorescent Reseonance Energy Transfer (FRET):

We carried out this protocol in a LightCycler 480 system (Roche Diagnostics, Basel, Switzerland). The amplification primers are not labelled but we use two sequence specific probes: ED-Anchor: 5´-CAAACTGCAGGGGAGCTACTGATAATGCTTGGAA-3´ labelled in its 3´end with Fluorescein, and ED-Sensor: 5´-TGTGCCAGGCACTGCCTG-3´ labelled with Cy5 and Phosphotionate at its 5´and 3´ ends respectively. PCR products along with the probes are subjected to Melting curves analysis in four steps: 95 °C for 5 s, 45 °C for 1 s, 80 °C for 20 s and 40 °C for 0 s (with temperature transfer speed of 2.2 °C/s). In the third step (from 45 ºC to 80ºC), a continuous fluorimetric register is performed (7 acquisitions per ºC). Melting curves are converted to melting peaks by calculating the negative derivative of the fluorescence with respect to temperature (–dF/dT) against temperature (T). Supplementary figure 3 shows representative plots derived from the genotyping of three different samples by using this protocol.

Legend to supplementary figure 1: Plots resulting from the genotyping of the ESR1-NCD1 deletion in wild type, ESR1-NCD1 heterozygous and ESR1-NCD1 homozygous samples through capillary electrophoresis in a CEQ 8000 automatic sequencer (Beckman Coulter, Inc., Fullerton, CA, USA). 239 and 260 fragment size peaks correspond to wild type and deleted alleles respectively. Fragment sizes (180-300) corresponding to GenomeLab DNA Size Standard Kit – 600 (Beckman Coulter, Inc., Fullerton, CA, USA) are also indicated.

Legend to supplementary figure 2: Plots resulting from the genotyping of the ESR1-NCD1 deletion in wild type, ESR1-NCD1 heterozygous and ESR1-NCD1 homozygous samples by using PyrosequencingTM (Biotage AB, Uppsala, Sweden). Each genotype is determined by characteristic pyrogram profiles. A: pyrogram for wild type sample corresponding to the sequence “CTGC”. B: pyrogram for ESR1-NCD1 homozygous sample corresponding to “TCCCT”. C: pyrogram for ESR1-NCD1 heterozygous sample corresponding to an equimolar mixture of sequences “CTGC” and “TCCCT”.

Legend to supplementary figure 3: Plots resulting from the genotyping of the ESR1-NCD1 deletion in wild type, ESR1-NCD1 heterozygous and ESR1-NCD1 homozygous samples by using Fluorescense Energy Transfer technology in the LightCycler 480 system (Roche Diagnostics, Basel, Switzerland). Melting peaks at 63.4 ºC and 69.3 ºC correspond to the deleted and the wild type alleles, respectively.