Sequence-Defined Transposon Mutant Library Ofburkholderiathailandensis

Sequence-defined transposon mutant library ofBurkholderiathailandensis

Larry A Gallagher, Elizabeth Ramage, RapatbhornPatrapuvich, Eli Weiss, Mitch Brittnacher and Colin Manoil

SUPPLEMENTARY METHODS

Mutant identification. Semi-degenerate PCR and sequencing of the transposon-genome junction fragments was carried out in 384-well formatusing either TSG polymerase (Lamda Biotech) or KAPA polymerase (KapaBiosystems) bythe following steps:

Pre-PCR (carried out only when using TSG polymerase throughout). PCR master mix was prepared on ice and distributedto the wells of 384-well PCR reaction plates (Bio-Rad, item# HSP3841) on ice (9 µL per well). Thawed cultures from mutant storage plates were added directly to the wells (1 µL per well). Plates were sealed(Applied Biosystems, item# 4306311), mixedby vortexing,briefly centrifuged to bring the reaction mixes to the bottom of the wells, then subjected to thermocycling.

Pre-PCR master mix:

µL/rxn / µL/plate
10X TSG buffer / 1.0 / 432
25 mM MgCl2 / 1.5 / 648
10 mMdNTPs / 0.2 / 86.4
10 µM primer lacZ-211 / 0.5 / 216
PCR-grade water / 5.7 / 2462.4
TSG enzyme / 0.1 / 43.2
Template (thawed culture) / 1.0 / -

Pre-PCR thermocycling:

Step / Temp / Time / Notes
1 / 94° / 12:00 / Colony denaturation
2 / 94° / 0:30
3 / 55° / 0:30
4 / 72° / 3:00
5 / Go to step 2 / 20 cycles total
6 / 4° / hold

PCR round 1. PCR master mix was prepared on ice and distributedto the wells of 384-well PCR reaction plates on ice (9 µL per well). Template consisting of either the Pre-PCR reaction mix (when using TSG polymerase) or thawed cultures from mutant storage plates(when using KAPA polymerase) was added (1 µL per well). Plates were sealed, mixed and briefly centrifuged as for Pre-PCR, then subjected to thermocycling.

PCR round 1 master mixes:

TSG Polymerase / KAPA Polymerase
µL/rxn / µL/plate / µL/rxn / µL/plate
10X TSG buffer / 1.0 / 432 / 5X KAPA GC buffer
25 mM MgCl2 / 1.5 / 648 / with 2 mM MgCl2 / 2.0 / 864
10 mMdNTPs / 0.2 / 86.4 / 10 mMdNTPs (KAPA) / 0.3 / 129.6
10 µM primer lacZ-211 / 0.5 / 216 / 10 µM primer lacZ-211 / 0.3 / 129.6
10 µM degenerate primer mix* / 0.5 / 216 / 10 µM degenerate primer mix* / 0.3 / 129.6
PCR-grade water / 5.2 / 2246.4 / PCR-grade water / 6.0 / 2592
TSG enzyme / 0.1 / 43.2 / KAPA HiFiHotStart polymerase / 0.1 / 43.2
Template (Pre-PCR reaction) / 1.0 / - / Template (thawed culture) / 1.0 / -

* Degenerate primer mix was an equimolar mixture (10 µM total concentration) of three oligonucleotides. The initially-used mixturecomprised oligonucleotides CEKG-2E, CEKG-2K and CEKG-2L. For better amplification of GC-rich DNA with TSG polymerase (see text),the mixture was changed to oligonucleotides CEKG-2A, CEKG-2B and CEKG-2D. When using KAPA polymerase, the mixture comprisedoligonucleotides CEKG-2O, CEKG-2P and CEKG-2S.

PCR round 1 thermocycling:

TSG Polymerase / KAPA Polymerase
Step / Temp / Time / Notes / Step / Temp / Time / Notes
1 / 94° / 5:00 / 1 / 95° / 2:00 / Colony denaturation
2 / 94° / 0:30 / 2 / 98° / 0:20
3 / 55° / 0:30 / -1° per cycle / 3 / 56° / 0:20 / -1° per cycle
4 / 72° / 3:00 / 4 / 72° / 2:00
5 / Go to step 2 / 6 cycles total / 5 / Go to step 2 / 6 cycles total
6 / 94° / 0:30 / 6 / 98° / 0:20
7 / 64° / 0:30 / 7 / 65° / 0:20
8 / 72° / 3:00 / 8 / 72° / 2:00
9 / Go to step 6 / 25 cycles total / 9 / Go to step 6 / 25 cycles total
10 / 72° / 7:00 / 10 / 72° / 10:00
11 / 4° / hold / 11 / 4° / hold

PCR round 2. Plates wereprepared in a manner analogous to that described for PCR round 1 and subjected to thermocycling.

PCR round 2 master mixes:

TSG Polymerase / KAPA Polymerase
µL/rxn / µL/plate / µL/rxn / µL/plate
10X TSG buffer / 1.0 / 432 / 5X KAPA GC buffer
25 mM MgCl2 / 1.5 / 648 / with 2 mM MgCl2 / 2.0 / 864
10 mMdNTPs / 0.2 / 86.4 / 10 mMdNTPs (KAPA) / 0.3 / 129.6
10 µM primer lacZ-148 / 0.5 / 216 / 10 µM primer lacZ-148 / 0.3 / 129.6
10 µMprimer CEKG-4 / 0.5 / 216 / 10 µM primer CEKG-4 / 0.3 / 129.6
PCR-grade water / 5.2 / 2246.4 / PCR-grade water / 6.0 / 2592
TSG enzyme / 0.1 / 43.2 / KAPA HiFiHotStart polymerase / 0.1 / 43.2
Template (PCR round 1 reaction) / 1.0 / - / Template (PCR round 1 reaction) / 1.0 / -

PCR round 2 thermocycling:

TSG Polymerase / KAPA Polymerase
Step / Temp / Time / Notes / Step / Temp / Time / Notes
1 / 94° / 5:00 / 1 / 95° / 2:00
2 / 94° / 0:30 / 2 / 98° / 0:20
3 / 64° / 0:30 / 3 / 65° / 0:15
4 / 72° / 3:00 / 4 / 72° / 2:00
5 / Go to step 2 / 30 cycles total / 5 / Go to step 2 / 30 cycles total
6 / 72° / 7:00 / 6 / 72° / 10:00
7 / 4° / hold / 7 / 4° / hold

Cleanup. Cleanup master mix was prepared on ice and distributed to the wells of 384-well PCR reaction plates on ice (3 µL per well). PCR Round 2 reaction mix was added (5 µL per well), the plates were sealed, mixed and briefly centrifuged, then subjected to thermal incubation:

Cleanup master mix:

µL/rxn / µL/plate
1 U/µL Shrimp Alkaline Phosphatase (USB) / 2.0 / 864
10 U/µLExonuclease I (USB) / 1.0 / 432

Cleanup incubation:

Step / Temp / Time / Notes
1 / 37° / 30:00
2 / 80° / 20:00 / Enzyme inactivation
3 / 4° / hold

Sequencing reaction. Sequencing reaction master mix was prepared on ice and distributedto the wells of 384-well PCR reaction plates on ice (6.4 µL per well). Cleanup reaction mix was added (1.6 µL per well), the plates were sealed, mixed and briefly centrifuged, then subjected to thermocycling.

Sequencing reaction master mixes:

When TSG Polymerase used for PCR / When KAPA Polymerase used for PCR
µL/rxn / µL/plate / µL/rxn / µL/plate
5X BigDye Dilution Buffer (ABI) / 1.0 / 432 / 5X BigDye Dilution Buffer (ABI) / 1.475 / 637.2
10 µM sequencing primer* / 1.0 / 432 / 10 µM sequencing primer* / 1.0 / 432
PCR-grade water / 3.4 / 1468.8 / PCR-grade water / 3.675 / 1587.6
BigDye Terminator version 3.1 / 1.0 / 432 / BigDye Terminator version 3.1 / 0.25 / 108
Template (cleanup reaction) / 1.6 / - / Template (cleanup reaction) / 1.6 / -

* Sequencing primer waslacZ-124L for transposon T8 and lacZ-124L2 for transposon T23.

Sequencing reaction thermocycling:

Step / Temp / Time / Notes
1 / 94° / 5:00
2 / 94° / 0:30
3 / 50° / 0:10
4 / 60° / 4:00
5 / Go to step 2 / 30 cycles total
6 / 4° / hold

Precipitation and sequencing. 20 µL of fresh 90% isopropanol was added to each well of the sequencing reaction plates. The plates were sealed (Alumaseal II, ISC Bioexpress item# T-2426-1), mixed by vortexing and centrifuged (right side up) at 3,000 x g for 30 minutes. The plates were then un-sealed and centrifuged inverted over paper towels at 850 rpm for 2 minutes. 20µL of fresh 70% isopropanol was added to each well. The plates were sealed (but not mixed) and centrifuged at 3,000 x g for 30 minutes, then unsealed and centrifuged inverted over paper towels at 850 rpm for 2 minutes. The plates were incubated at 37°C for 30 minutes to dry. 12 µL of PCR-grade water was added to each well, the plates were heat sealed (Thermo Scientific Easy Peel Heat Sealing Film, Fisher Scientific Item# AB-0745), mixed and briefly centrifuged to collect the liquid at the bottom of the wells, and stored at -20° C until loaded on an ABI 3730 for sequencing. Chromatogram files were analyzed using custom scripts which parsed transposon and genome portions of the sequence reads and mapped the genome portions against the genome sequence.

Mutant pool Tn-seq. The Tn-Seq circle method was carried out as described (Gallagher, et al. 2011. mBio 2(1):e00315-10) with the following modifications:

Step / Modifications
Circularization / 30 µL reaction volume (rather than 15 µL).
Used collector probe T23_COLLECT_1.
Amplification / Used amplification primers T23_SLXA_FOR_AMP2 and SLXA_REV_AMP.
Sequencing / Used sequencing primer T23_SEQ_G.
Data processing / Read counts per location were normalized only for total mapped reads per Tn-seq run.

FLP recombination of T23 insertion mutants. The following oligonucleotide primers were used for the colony PCR shown in Fig 4:

Mutant set / Primer F / Primer R / Primer Tn
argJ::T23 / BTH_I1128_testF1 / BTH_I1128_testR1 / lacZ-148
hisD::T23 / BTH_I2993_testR1 / BTH_I2993_testF1 / lacZ-148
purN::T23 / BTH_I0772_testR1 / BTH_I0772_testF1 / lacZ-148

Oligonucleotide sequences.

Oligo / Sequence
lacZ-211 / TGCGGGCCTCTTCGCTATTA
CEKG-2A / GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG
CEKG-2B / GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC
CEKG-2D / GGCCACGCGTCGACTAGTACNNNNNNNNNNGCTC
CEKG-2E / GGCCACGCGTCGACTAGTACNNNNNNNNNNATGTA
CEKG-2K / GGCCACGCGTCGACTAGTACNNNNNNNNNNAGTGC
CEKG-2L / GGCCACGCGTCGACTAGTACNNNNNNNNNNCTGAG
CEKG-2O / GGCCACGCGTCGACTAGTACNNNNNNNNNNCCGG
CEKG-2P / GGCCACGCGTCGACTAGTACNNNNNNNNNNCGAG
CEKG-2S / GGCCACGCGTCGACTAGTACNNNNNNNNNNGTCC
lacZ-148 / GGGTAACGCCAGGGTTTTCC
CEKG-4 / GGCCACGCGTCGACTAGTAC
lacZ-124L / CAGTCACGACGTTGTAAAACGACC
lacZ-124L2 / CAGTCACGACGTTGTAAAACGACG
T23_COLLECT_1 / CGGCGCGCCCTAGGGGGATCCAAGCAGAAGACGGCATACGAGCTCTTCC
T23_SLXA_FOR_AMP2 / AATGATACGGCGACCACCGAGATCTGAATAGGAACTTCGGAATAGGAACTTCTTAGATGTGTATAAGAGACA
SLXA_REV_AMP / CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
T23_SEQ_G / AATAGGAACTTCGGAATAGGAACTTCTTAGATGTGTATAAGAGACAG
BTH_I0772_testR1 / GTCTGGCCAATCAGGAAACC
BTH_I0772_testF1 / GCCTTCGTCGCCAAATATGA
BTH_I1128_testF1 / GATCGCTCGTTCAACTGCAT
BTH_I1128_testR1 / TCTTCGAGATACGCGGGATT
BTH_I2993_testR1 / AACGGATGACAGCATGGCTA
BTH_I2993_testF1 / GCACGAGATCGTTCTTCACG

Page 1