Richard Resnick: Welcome to the genomic revolution Name______
A TEDx Talk from July 2011 http://www.ted.com/talks/richard_resnick_welcome_to_the_genomic_revolution.html
The following talk was recorded in 2011 and addresses an important topic in modern biotechnology. That topic is whole genome testing and the controversial use of the information it provides. This is a topic for bioethics.
Before listening, provide definitions for the following
1. Bioethics ______
2. Genome ______
3. Whole genome sequencing______
4. Mutation ______
The video will describe two possible changes to the DNA code and both contribute to disease. One is called a deletion, the other a point mutation. The letters below are meant to represent DNA sequence. Label the changes to the sequence as either a deletion or a point mutation.
Initial (or normal) sequence AAGTGTTGCGTCCGTGAAAAACGTCCGTCCATGCCGTTGTGCG
5. A change in the DNA results in a
sequence to the right. Is this AAGTGTTGCGTCCGTG TGCCGTTGTGCG
a deletion or a point mutation?
6. A change in the DNA results in a
sequence to the right. Is this AAGTGTTGCGTCCGTGAATAACGTCCGTCCATGCCGTTGTGCG
6. a deletion or a point mutation?
Richard Resnick tells how cheap and fast genome sequencing is about to turn health care (and insurance, consumer products and politics) upside down.
_____ 7. Which of the following characterizes the first time sequencing of the human genome?
a. It cost $3.8 million and took 15 years
b. It costs $10,000 and can be complete in a week, currently 50 to 60,000 individual genomes a year
c. It costs $100 and is widely available to all
_____ 8. What is the current status of human genome sequencing?
a. It cost $3.8 million and took 15 years
b. It costs $10,000 and can be complete in a week, currently 50 to 60,000 a year
c. It costs $100 and is widely available to all
_____ 9. What does affordable genomic sequencing mean for medicine?
a. Improved treatments (cancer described in this report)
b. Improved diagnosis (dopa-responsive dystonia in this report)
c. Prescreening to see if you are more likely to develop a disease (mutated p53 in this report)
d. all choices
_____ 10. Mr. Resnick address the use of GMO’s in our food supply. What is his opinion?
a. It is a threat to mankind c. It is a necessity to support a growing human population
b. It will benefit some populations d. He has no interest in this products and whether they are used
______11. Which of the following was not provided as way whole genome sequencing might be used?
a. Consumer use such as genetic compatibility or ability to purchase insurance
b. Diagnostic use for medical care
c. To determine if you are fit for a profession or public office
d. To find long lost, distant or unknown relatives
e. Its use in forensics, law enforcement and human identification in disasters
Please read the following article: NIH Studies Explore Promise of Sequencing Babies’ Genomes
Note the following from the article that are important for understanding the report.
Biochemical marker tests- any hormone, enzyme, antibody, or other substance that is detected in the urine, blood, or other body fluids or tissues that may serve as a sign of a disease or other abnormality
Phenylketonuria------a metabolic disorder in which an enzyme that uses phenylalanine (an amino acid) is missing. This can be controlled with diet. People with this disorder cannot use Nutrasweet
The exome ------These are only the protein-coding DNA which is only 1% of our DNA
What are the Four Projects funded by NIH and described in this article? (12-15)
Site of Study Project
UCSF______
UNC ______
Children’s Mercy Hospital, KC______
Boston______
You will have to make this decision. Will you have your genome sequenced? What about the genome of your children if you chose to have a family? Support your answer with at least 2 reasons why or why not! (5 points)
Richard Resnick: Welcome to the genomic revolution Name______
A TEDx Talk from July 2011 http://www.ted.com/talks/richard_resnick_welcome_to_the_genomic_revolution.html
The following talk was recorded in 2011 and addresses an important topic in modern biotechnology. That topic is whole genome testing and the controversial use of the information it provides. This is a topic for bioethics.
Before listening, provide definitions for the following
1. Bioethics: the study of typically controversial ethics brought about by advances in biology and medicine.
2. Genome:the entirety of an organism's hereditary information. It includes both the genes and the non- coding sequences of the DNA/RNA.
3. Whole genome sequencing: the process that determines the complete DNA sequence of an organism's genome
4. Mutation: a change of the nucleotide sequence of the genome of an organism
The video will describe two possible changes to the DNA code and both contribute to disease. One is called a deletion, the other a point mutation. The letters below are meant to represent DNA sequence. Label the changes to the sequence as either a deletion or a point mutation.
Initial (or normal) sequence AAGTGTTGCGTCCGTGAAAAACGTCCGTCCATGCCGTTGTGCG
5. A change in the DNA results in a
sequence to the right. Is this AAGTGTTGCGTCCGTG TGCCGTTGTGCG
a deletion or a point mutation?
6. A change in the DNA results in a
sequence to the right. Is this AAGTGTTGCGTCCGTGAATAACGTCCGTCCATGCCGTTGTGCG
6. a deletion or a point mutation?
Richard Resnick tells how cheap and fast genome sequencing is about to turn health care (and insurance, consumer products and politics) upside down.
_____ 7. Which of the following characterizes the first time sequencing of the human genome?
a. It cost $3.8 million and took 15 years
b. It costs $10,000 and can be complete in a week, currently 50 to 60,000 individual genomes a year
c. It costs $100 and is widely available to all
_____ 8. What is the current status of human genome sequencing?
a. It cost $3.8 million and took 15 years
b. It costs $10,000 and can be complete in a week, currently 50 to 60,000 a year
c. It costs $100 and is widely available to all
_____ 9. What does affordable genomic sequencing mean for medicine?
a. Improved treatments (cancer described in this report)
b. Improved diagnosis (dopa-responsive dystonia in this report)
c. Prescreening to see if you are more likely to develop a disease (mutated p53 in this report)
d. all choices
_____ 10. Mr. Resnick address the use of GMO’s in our food supply. What is his opinion?
a. It is a threat to mankind c. It is a necessity to support a growing human population
b. It will benefit some populations d. He has no interest in this products and whether they are used
______11. Which of the following was not provided as way whole genome sequencing might be used?
a. Consumer use such as genetic compatibility or ability to purchase insurance
b. Diagnostic use for medical care
c. To determine if you are fit for a profession or public office
d. To find long lost, distant or unknown relatives
e. Its use in forensics, law enforcement and human identification in disasters
Please read the following article: NIH Studies Explore Promise of Sequencing Babies’ Genomes
Note the following from the article that are important for understanding the report.
Biochemical marker tests- any hormone, enzyme, antibody, or other substance that is detected in the urine, blood, or other body fluids or tissues that may serve as a sign of a disease or other abnormality
Phenylketonuria------a metabolic disorder in which an enzyme that uses phenylalanine (an amino acid) is missing. This can be controlled with diet. People with this disorder cannot use Nutrasweet
The exome ------These are only the protein-coding DNA which is only 1% of our DNA
What are the Four Projects funded by NIH and described in this article? (12-15)
Site of Study Project
UCSF______
UNC ______
Children’s Mercy Hospital, KC______
Boston______
You will have to make this decision. Will you have your genome sequenced? What about the genome of your children if you chose to have a family? Support your answer with at least 2 reasons why or why not! (5 points)