1
J. Biol. Chem. Environ. Sci., 2011, 6 (3), 445-454
Journal / MOLECULAR CLONING AND EXPRESSION STUDIES OF A FULL LENGTH c-DNA CODING FOR TREHALOSE 6-PHOSPHATE FROM EGYPTIAN DURUM WHEAT
Hassan Salem1, Faten Abou-Elella 1 , Ayman A. Diab 2, Lamiaa Salah EL Den2.
J. Biol. Chem.
Environ. Sci., 2011,
Vol.6(3): 445-454
/ 1Biochemistry Department, Faculty of Agriculture, CairoUniversity,
2Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Ministry of Agriculture, Egypt.
Abstract
A series of experiments were conducted on the leaves of Durum wheat sohag variety 3 under normal and dehydration shock stress conditions (2, 4, 6 hours) in order to examine the magnitude of the TPP gene response to dehydration.
The full length of TPP gene was isolated by RACE-PCR yielding a length of 1458 bP. Bioinformatics analysis was used in order to perform a profiling for the TPP gene expression after being isolated by RT-PCR. Semi-quantitative RT-PCR and real time quantitative PCR indicated that the expression of this gene is upregulated in response to drought stress. Aphylogentic analysis was performed to related the closest species to the wheat revealing the Oryza sativa which also shown similarity in the comparative mapping revealing that the TPP gene sequence in the Durum wheat to be found on the Oryza sativa on chromosome 8 .
The Bioinformatics analysis and the conducted experiment confers that the TPP level increased under the dehydration stress indicating an up regulation for the gene and proving to be a membrane stabilizer.
Key words:Durum wheat, dehydration shock stress, RT-PCR, RACE-PCR. Bioinformatics.
Abbreviations:TPP Trehalose-6-phosphate phosphatase
INTRODUCTION
The explosive increase in world population, along with the continuing deterioration of arid land, scarcity of fresh water, and increasing environmental stress pose serious threats to global agricultural production and food security.
Despite focused efforts to improve major crops for resistance to abiotic stresses (Boyer, 1982) such as drought, excessive salinity, and low temperature by traditional breeding, success has been limited. This lack of desirable progress is attributable to the fact that tolerance to abiotic stress is a complex trait that is influenced by coordinated and differential expression of a network of genes. Fortunately, it is now possible to use transgenic approaches to improve abiotic stress tolerance in agriculturally important crops with far fewer target traits than had been anticipated (Zhang et al., 2001).
Abiotic stresses can directly or indirectly affect the physiological status of an organism by altering its metabolism, growth, and development. A common response of organisms to drought, salinity, and low-temperature stresses is the accumulation of sugars and other compatible solutes (Hare et al., 1998). These compounds serve as osmoprotectants and, in some cases, stabilize bimolecular under stress conditions (Yancey et al., 1982; Hare et al., 1998).
One such compound is trehalose, a nonreducing disaccharide of glucose, which plays an important physiological role as an abiotic stress protectant in a large number of organisms, including bacteria, yeast, and invertebrates (Crowe et al., 1992). Trehalose has been shown to stabilize dehydrated enzymes, proteins, and lipid membranes efficiently, as well as protect biological structures from damage during desiccation. In the plant kingdom, most species do not seem to accumulate detectable amounts of trehalose, with the notable exception of the highly desiccation-tolerant ‘‘resurrection plants’’ (Wingler, 2002).
Attempts to accumulate trehalose in higher plants by introducing trehalose biosynthesis genes from microorganisms have produced transgenic tobacco (Holmstrom et al., 1996; Pilon-Smits et al., 1998) or rice plants (Garg et al., 2002; Jang et al., 2003) that showed significant tolerance against various abiotic stresses.
This study was undertaken to investigate the trehalose 6 phosphate (TPP) gene ability for drought tolerant in Durum wheat.
MATERIALS AND METHODS
Plant material and dehydration shock treatment growth conditions:
Durum wheat Seeds (variety Sohag 3) were sterilized in 10% sodium hypochlorite for 30 min and then rinsed with bidistilled water for 1 min 15 times. Plants were grown in soil composed of sand and clay (1:1) for three weeks and irrigated daily under controlled conditions (25ºC day/16ºC night, 12-h photoperiod). Plants were removed from soil, washed carefully and placed on paper towels for different periods (0, 2, 4, 6h),after wards the leaves were harvested, frozen in liquid nitrogen and stored at-80°C for the RNA extraction according to Ozturk et al,(2002).
RNA Isolation and RT-PCR from Durum wheat leaves:
Total RNA was extracted from the harvested leaves according to the procedure of Chomczynski. (1993) using the TriPure isolation reagent (Cat No 1667165). RNA product (8 µl) was mixed with 1 µl RQ1 RNase-Free DNase 10X Reaction Buffer. And 1 µl of RNA RQ1 RNase-Free DNase (1u / µg) and incubated at 37°C for 30 minutes, then 1 µl of RQ1 DNase stop solution was added to terminate the reaction, and RQ1 DNase was inactivated by incubation at 65°C for 10 minutes.RT-PCR was carriedout usingthe ImProm-II™ Reverse Transcription System of c-DNA" ImProm-II™ promega cat.N.o A3800 kitusing primers. TPP gene was used to design gene-specific primers for RT-PCR The procedure for amplifying TPT was” ATGGATTTGAGCAATAGCTC”Forward primer,”ACACTGAGTGCTTCTTCCAT” Reverse primer. The reactions of PCR were carried out in a Thermo Hybrid PCR instrument, PCR amplification conditions were : 94°C for 4 minutes (1 cycle); 94°C for 1 minute, 55°C for 1 minutes, 72°C for 2 minute (for 35 cycles); 72°C for 10 minutes (1 cycle), then soacked at 4°C.Three tubes for PCR reactions assembled (experimental reaction-positive control (18s rRNA)-negative control of second strand synthesis and negative control of second strand synthesis tubes ddH2O were added.
“Rapid amplification of cDNA ends" (RACE PCR):
Rapid amplification of cDNA PCR was doneacording to Frohmann, (1994) Rochecat N.o 1734792, Isolation and characterization of 5´ends from low-copy RNA messages. Gene-specific primer SP1 is required to transcribe the mRNA into first-strand cDNA SP1 primer GGACGAACCTCTAAAACCATTC .A second, nested primer SP2 located upstream of SP1 is used for the first PCR amplification. For a second PCR SP2 1ST PCR primer CCTCCAGCACTTCGTTTACGAG round and use a further nested primer SP3.SP3 2nd AAACCTCATCGATCATAGGCAGAAA designed according to the gene sequences. PCR products were migrated by electrophoresis on 1% (W/V) agarose gel.
PCR confirmations of TPP clone:
PGEM-T Easy vectors. Cat N.o A1360 was used. Ligation reactions were set up. The recombinant colonies were identified by carrying the insert .Another amplification reaction was made utilizing SP6 and T7 universal primers which their sites located on pGEM-T easy vector, the same conditions was used except for the annealing temperature would be 50°C for 1 min.
Sequencing of the cDNA inserts:
The automated DNA sequencing reactions were performed using ABI PRISM Big Dye terminator cycle sequencing ready reaction kit (PE Applied Biosystem, USA), in conjunction with ABI PRISM (310 Genetic Analyzer). Cycle sequencing was performed using the gene amp 2400 thermal cycler, according to Sanger et al. (1977). Homology search was performed using BLASTX against the NCBI protein database ( of plant TPP genes that showed similarity to the TPP gene were obtained from the NCBI non redundant and dbEST data sets using BLASTX or BLASTP (ver. 2.0.10)(Altschul et al., 1990). The full amino acid sequences of the proteins were aligned using CLUSTAL W (ver. 1.8) (Thompson et al., 1994)and subjected to phylogenetic analysis. Phylogenic trees were constructed using the neighbor-joining (NJ) method (Saitou and Nei, 1987) with parsimony and heuristic search criteria and 1000 bootstrap replications to assess branching confidence, boxshade 3.2.2 software and office 2003 Microsoft word were used for shading alignment and highlighting conserved domains respectively.
Semi-quantitative RT-PCR analysis:
One µl of cDNA reaction mixture was diluted with 9 µl DEPC treated water, then, 1 µl of diluted mixture was used to perform Semi-quantitative RT-PCR reaction as followed 1.0 l dNTPS (10 mM)was mixed with 2.5 l MgCl2 (25 mM) and 5.0 l 10X buffer was added to 5.0 l Forward primer (10 pmol/l) and 5.0 l Reverse primer (10 pmol/l) mixed to 1.0 l Template cDNA (25 ng/l) andadded 0.5 l Taq (5 U/l) finally, up to 50 l dd H2O.The amplification was carried out in Hybaid PCR Express system programmed with specific primers for TPP and 18S (as a control to normalize for the amount of cDNA present in each sample) genes as follows: 5 min at 95°C, followed by 35 cycles at 95°C for 45 s, 55°C for 60 s, 72°C for 2 min, 72°Cfor 5 min. For each sample, 10 l of the amplification reaction was size-fractionated on a 1% (w/v) agarose gel.
Real-time PCR:
Real-time PCR was performed using iQ SYBR Green Sypermix (BIO-RAD, USA). Real-time PCR (QPCR) reaction was applied by :12.5 l of iQ SYBR Green Sypermix was mixed with 2.0 l Forward primer (10 pmol/l), and 2.0 l Reverse primer (10 pmol/l), then 1.0 l Template cDNA (25 ng/l) was mixed well , finally up to up to 25 l dd H2O. Reactions were run on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA) condition was 4 min at 94°C, 40 cycles of 30 s at 94°C, 60 s at 55°C, and 2 min at 72°C. PCR products were examined by melt curve analysis. For each cDNA sample, 18s levels were also quantified in the same run. Expression levels relative to 18s were then calculated using the StepOne™ software v2.1 package, which compares reaction take off points. (Livak and Schmittagen, 2001).
Trehalase enzyme assay:
Preparation of crude extract:
100mg control and drought treated leaves (0, 2, 4, 6 h) were ground with liquid nitrogen by using mortar and pestle. The powder were then suspended in ice-cold suspension solution containing 0.1 M citrate (Na+), pH 3.7, 1 mM PMSF, 2 mM EDTA and insoluble polyvinylpyrrolidone (10 mg/g dried weight). For 1 g dry weight of suspension culture 2 ml of extraction buffer was used. The homogenate was filtered through two layers of cheesecloth and centrifuged at 31,500 rpm (48,000 g) for 30 min at 4 8 oC in Sorval Combi Plus with T-880 type rotor. The supernatant was used for the enzyme assays. The protein concentration was performed according to (Bradford, 1976) using bovine serum albumin (BSA) as standard.
Assay of trehalase:
Trehalase enzyme activity was measured using glucose oxidase– peroxidase kit (Bicon) (Muller et al, 1992). The enzyme assay is based on the measurement of glucose produced by hydrolysis of trehalose. The reaction mixture was composed of 10 mM trehalose, 50 mM MES (K+), pH 6.3 and 0.2 mg crude extract in a final volume of 1 ml. It was incubated at 37 oC for 30 min. The reaction was started by the addition of trehalose to the reaction mixture, which was preincubated at 37 oC for 10 min, 100 ml of samples were taken from the reaction mixture and immediately put in thermostat at 100 oC for 3 min to stop the reaction. Precipitates were removed by centrifugation at 8700 rpm for 10 min in microcentrifuge. For the analysis, 10 ml of the supernatant was mixed with 1 ml of glucose oxidase – peroxidase kit solution, mixed by vortex and then the mixtures were incubated at 37 oC for 15 min. The absorbance of the sample was measured at 470 nm in Schimadzu UV-1201 spectrophotometer against blank solution. The increase in the absorbance against time was assumed to be equal to the amount of glucose formed. One unit of trehalase activity is defined as the amount of enzyme that catalyzes the hydrolysis of 1 mmol of trehalose/ min at 37 oC at pH 6.3.
Insilico mapping:
The trehalose 6 phosphate sequence was compared to rice BAC/PAC sequences using BLAST (with an E-value threshold of 1e-10). The rice BAC/PAC that matches the query was used to identify anchored rice markers from the rice genetic linkage map ( The results obtained from this stage were used to construct a comparative map between durum wheat, rice, oat. To identify the tentative chromosomal location of trehalose 6 phosphate in durum wheat, rice, oat, using comparative mapping strategy.
RESULTS AND DISCUSSION
Isolation of TPP gene:
The TPP1 gene was about 945 bp as result from RT- PCR.The full length of gene TPPwhich obtained by RACE a PCR product of (1458 bp) band was obtained, Fig. 1.and Fig.2.
Fig. 1. 1% agarose gel electrophoresis of digestion of candidate colonies plasmid DNA with EcoRI enzyme, (M) 1kb marker,(1) pGEM.Tvector, (2, 3, 4) (TPP) gene (5) positive colony plasmid DNA digestion.
Fig. 2: A) Nucleotide sequence of (TPP1) gene representing 1458 bp as obtained from the ABI PRISM 310 DNA sequencer. (B): The Sequence Manipulation Suite: Protein Molecular Weight Deduced Amino Acid Sequence and Phylogenetic Relationship of TPP1gene.
To determine the evolutionary relatedness of TPP gene to TPP proteins isolated from other species, the neighbor joining method (NJ) was used to generate a gene tree based on amino acid sequence homology of the region of TPP isolated genes to those of TPP proteins (Fig.3,4). The multiple sequence alignment showed that functional protein TPP gene has a high degree of similarity 93%with Oryza sativa(OsTPP), 56% with Arabidopsis thaliana(ArTPP), 56% with Nicotiana tabacum(NtTPP), 53% with (ZmTPP)Zea mays,, 45% with A.lyrata (ArLTPP).
Fig.3.Phylogenetic tree based on sequences of the relationship of (TPP1) with other plants. The deduced sequences were aligned with CLUSTALW. The phylogenetic tree was constructed by the neighbor-joining including Arabidopsis lyrata (ArLTPP), Zea mays (ZmTPP), Arabidopsis thaliana (ArTPP), Nicotiana tabacum(NtTPP), Oryza sativa (OsTPP), TPP new.
Fig.4. Alignment of the predicted amino acid sequence of TPP1 and those of several other plants including Arabidopsis lyrata (ArLTPP), Zea mays (ZmTPP), Arabidopsis thaliana (ArTPP), Nicotiana tabacum(NtTPP), Oryza sativa (OsTPP), TPP new
TPP gene expression:
Under dehydration shock, the expression of TPP gene in leaf was upregulated at 4 h and decreased to normal at 2 and 6 h Fig .5. These results suggest that Durum wheat TPP participates in the response to dehydration shock stress. The re-upregulation of Durum wheat TPP appears to lead to an accumulation of trehalose and to maintain the expression of genes that produce osmoprotectants because the content of trehalose is too low to serve as a protectant (Garg et al. 2002; Schluepmann et al. 2004; Ge et al. 2008). Rice seedlings treated with 1% (w/v) NaCl accumulated trehalose at a rate of 7 μg per 100 mg of fresh weight at the third day, but were undetectable on the second day (Garcia et al. 1997). Earlier reports indicated that Arabidopsis, and many other higher plants, accumulate trehalose at only trace levels (Blázquez et al. 1998; Garg et al. 2002; Chary et al. 2008). This is probably due to the low-level activity of synthesis enzymes and relatively high level of trehalase activity (hydrolytic enzyme) (Vogel et al. 1998; Van Dijck et al. 2002). The accumulation of trehalose was increased dramatically in soybean, cowpea, tobacco, and Arabidopsis after trehalase activity was inhibited by validamycin A (Müller et al. 1995; Goddijn et al. 1997; Müller et al. 2001). Over-expression of exogenous or endogenous TPS and TPP encoding genes in transgenic plants led to an increase of abiotic tolerance, but the trehalose content was still very low (Garg et al. 2002; Jang et al. 2003; Avonce et al. 2004; Karim et al. 2007; Miranda et al. 2007). Rice plants tend to sustain a static TPP activity and that the activity raises to a peak around 4 h of the chilling stress (12 Cо), which was followed by a decline to it initial level after 8 h .This immediate and transient increase in TPP activity during chilling stress follows the pattern of mRNA accumulation Pramanik and Imai (2005). We suggest that the major role of trehalose in higher plants is not osmotic protection, but signal transduction. Therefore, the mechanism of signal transduction involving trehalose in higher plants needs to be explored.
Fig.5. 1% agrose gel electrophoresis of comparison of (TPP1) expression patterns of leaves obtained by semiquantitative RT-PCR under dehydration shock treatment after 1: 0h, 2: 2h, 3:4h, 4:18S gene was used as control for relative amount of RNA.
Trehalase activity:
The trehalase specific activity was found to be the highest under control conditions in leaves of durum wheat Table (1). Trehalase activity normally keeps cellular trehalose concentrations low in order to prevent detrimental effects of trehalose accumulation on the regulation of carbon metabolism. Such a role of trehalase may be of particular importance in interactions of plants with trehalose-producing microorganisms. In support of this hypothesis, expression of the Arabidopsis trehalase gene and trehalose activity were found to be strongly induced by infection of Arabidopsis plants with the trehalose-producing pathogen Plasmodiophora brassicae(Brodmann et al 2002).In this study the effect of drought stress on trehalase activity of durum wheat species was examined. The trehalase activity was found to be the lowest in leaves with drought stress treatment. Trehalase is ubiquitous in higher plants and single-copy trehalase genes have been identified and functionally characterized from soybean (Glycine max) and Arabidopsis (Muller et al., 2001, Aeschbacher et al., 1999). It is likely that trehalase is the sole route of trehalose breakdown in plants as trehalose accumulates in the presence of the specific trehalase inhibitor validamycin A (Muller et al., 2001).Trehalase activities in cell and tissue cultures of gymnosperm Picea and of a series of mono- and dicotyledonous plants including three wheat callus lines were described (Kendall et al., 1990). Therefore, it can be safely concluded that trehalose activity is present in most of higher plants across all major taxonomic groups (Muller et al., 1995).
Table 1. Trehalase activity under dehydration shock treatments.
Hours / Enzyme activity0h / 1.004 d
2h / 0.7813 c
4h / 0.4273 a
6h / 0.7170 b
In-silico analyses:
In-silico mapping of rice was found to be matching with the sequence of TPP on chromosome 8 the marker was (AQ074215) ( “Comparative tetraploid wheat NDSU langdon QTL 2002” it found in chromosome 3A and Oat in “comparative oat Cornell Diploid 1995” Fig .6.
Fig .6. Comparative map showing the marker AQ074215 on Rice chromosome 8. This marker is closely linked between Oat and Tetraploid wheat.
REFERENCES
Aeschbacher,R.A.; Muller,J .; Boller,T.and Wiemken, A. (1999). Purification of the trehalase GMTRE 1 from soybean nodules and cloning of its cDNA: GMTRE 1 is expressed at a low level in multiple tissues, Plant Physiol. 119 : 489–496.