Wyder et al.1

Angiogenesis

Reduced pathological angiogenesis and tumor growth in mice lacking GPR4, a proton sensing receptor

Lorenza Wyder, Thomas Suply,Bérangère Ricoux, Eric Billy, Christian Schnell, Birgit U Baumgarten, Sauveur Michel Maira, Claudia Koelbing, Mireille Ferretti, Bernd Kinzel, Matthias Müller, Klaus Seuwen and Marie-Gabrielle Ludwig

Corresponding author:

Marie-Gabrielle Ludwig, Novartis Institutes for Biomedical Research, Switzerland

E-mail:

Online Resource 1

Supplementary Figure 1:GPR4 expression correlates with the profile of marker genes characteristic for endothelial cells

Altogether 178 genes of the 18,400 transcripts and variants (including 14,500 well-characterized human genes) represented on the Affymetrix 133A chip were found to have a correlation coefficient of 0.7 or higher to at least one of the 7 endothelial markers. The marker genes themselves correlated to each other with correlation coefficients between 0.79 and 0.94.

About two third of the genes identified by this method were described in the literature to be associated with endothelial cells. These included some very well known pan-endothelial markers such as PECAM1 (CD31), CD34, CTGF, FLT1 (VEGFR1), ephrins and their receptors (EFNA1, EFNB2, EPHB4), EDG1, ENG (CD105), NRP2 and ROBO4.

Among candidate genes which had some association with endothelial cells, GPR4had a maximum correlation coefficient of 0.73 to vWF. Correlation coefficients for the other endothelial markers were : 0.61 for CDH5, 0.62 for KDR, 0.58 for TIE, 0.67 for TEK, 0.66 for PTPRB, 0.62 for ANGPT2.

Material and Methods

See main text

Online Resource 2

Supplementary Figure 2: GPR4 mRNA downregulation by siRNA in HUVEC cells

Analysis of GPR4 expression in HUVECcells by RT-PCR upon transfection of GPR4 or control siRNAs.Values of GPR4 normalized to GAPDH amplified in the same sample are shown.

Material and Methods

qPCR

Quantitative PCR was performed using an ABI Prism7000 Real Time PCR cycler (Applied Biosystem) with Quantitect SYBR Green real time PCR buffer (Qiagen). Each reaction contained: 25µl 2X Quantitect SYBR Green PCR master mix, 1µl Forward primer (20mM), 1µl Reverse Primer (20mM), 19µl RNase-free water and 4 µl cDNA. Amplification was performed in 96-well optical reaction plate (Applied Biosystem) with the following program: initial denaturation at 95°C for 15 min followed by 45 cycles of 15s at 94°C, 30s at 50°C and 30s at 72°C. Following the final cycle, melting curve analysis was performed for all tested using ABI7000 software. Primers used for GPR4 and GAPDH were as described in the main text.

Online Resource 3

Supplementary Figure 3: Generation of GPR4-deficient mice

a) Targeting construct and strategy used to generate GPR4-deficient mice by homologous recombination in ES-cells. P1 – P4 denote the primers used to characterize integration of the targeting vector into the GPR4 locus (see Suppl. Materials and Methods). b) Southernblot on SacI-digested genomic DNA from a wild type (WT) and a GPR4-deficient mouse (GPR4 KO) with the probe depicted in panel A. c) RT-PCR for GPR4 in different organs of wild type and GPR4-deficient mice(RT+ and RT-, respectively). Clathrin-2K (Clathk) was used as control. d) RT-PCR for GPR4 in primary lung endothelial cells (Lung ECs) isolated from wild type or GPR4 KO mice, GAPDH was used as control.

Material and Methods

Generation of pRAY2-GPR4 targeting vector

Arms of homology were amplified by Polymerase Chain Reaction (PCR) from SV129 genomic DNA with the KOD HIFI DNA polymerase (Novagen). Primers were designed according to the sequence of the mouse GPR4 gene (mCG50351.1). The 5’ arm was amplified using sense primer CTGGCCATACTGGCCGGATGTGGCTCAGTTGTTAC and antisense primer CCGCTCGAGTCATGCTTATACCAGCGGTGTCATGCTTAT (product size 2.0 kb). The 3’arm was amplified with primer sense CCATCGATGGCTGGCAGATAAG GACAGACG and primer antisense ATAAGAATGCGGCCGCAGCCTCTTCAGTGA CTATCC (product size 1.5 kb). The resulting 5’ and 3’ arms were cloned in the pRAY2 vector (Genbank accession number U63120). All PCR fragments and the resulting vectors were sequence verified.

Generation of GPR4 knock out mice

Twenty µg of SfiI linearized targeting vector (pRAY2-GPR4) were electroporated into a internally established BALB/c embryonic stem (ES) cell line [37], subsequently cultured in the presence of 0.2 mg/ml G418 on mitotically inactivated mouse embryonic fibroblasts. The targeted mutation was identified by PCR using primers P1 TGATATTGCTGAAGAGCTTGGCGGC (in Neo gene) and P2 CACTTCCTCTCCCTCCTATTTG followed by a nested PCR with primers P3 AGCGCATCGCCTTCTATCGCC (in Neo gene) and P4 CCAGCACTGTAAGACCTTC (Suppl. Fig. 1a). Homologous recombination was confirmed by Southern blot analysis with an external 5’ probe (PCR product from primers cgtgcttgttaagcgaatac and agtcattccagaagcctaga) on SacI, BamHI, EcorV or HindIII digested genomic DNA. The neomycin probe (1.2 kb fragment from a BamHI NheI digested pRAY2 vector) revealed a single integration site. Positive ES cell clones were microinjected into C57BL/6 blastocysts and re-implanted in pseudo-pregnant foster mothers. The resulting male chimeras were crossed with BALB/c females to produce an F1 generation of inbred BALB/c GPR4 heterozygotic mice. Germ line integration was determined using fur color, and confirmed by PCR of tail genomic DNA. Breeding of these GPR4 heterozygote mice yielded homozygous GPR4 KO mice in a Mendelian ratio. Validation of the GPR4 disruption in adult mice was confirmed by Southern blot with the neomycin probe and an external 5’ probe (PCR product from primers cgtgcttgttaagcgaatac and agtcattccagaagcctaga) on SacI, BamHI, EcorV or HindIII digested genomic DNA.

Absence of GPR4 transcripts was evaluated on heart, kidney, liver, lung, spleen and testis cDNA from GPR4 KO and wild type mice. Mice were euthanized by CO2 inhalation and tissues were quickly removed and stored in RNA later (Ambion, Huntingdon, UK). RNA was prepared with the Absolutely RNA RT-PCR miniprep kit (Stratagene, Amsterdam, The Netherlands) and reverse transcribed with the Omniscript kit (QIAGEN, Basel, Switzerland). Multiplex PCR was performed with primers GCTGCCATGTGGACTCTCGA and CAGGAAGGCGATGCTGATAT for GPR4 and gctcacatgggaatgttcac and atgttgtcaaagttgtcataag for Clathrin-2K as control.

Purification of mouse endothelial cells

Mouse lung endothelial cells for RT-PCR studies were isolated and cultured according to the protocol described by Reynolds et al[36] with the modification that the positive sort was done with a 1:1 mixture of rat anti-mouse VE-cadherin (clone 11D4.1) and anti-CD31 (clone MEC13.3; both from Becton Dickinson, Allschwil, Switzerland)

References

36. Reynolds LE, Hodivala-Dilke KM (2006) Primary mouse endothelial cell culture for assays of angiogenesis. Methods Mol Med 120:503-509

37.Gassmann M, Shaban H, Vigot R et al(2004) Redistribution of GABAB(1) protein and atypical GABAB responses in GABAB(2)-deficient mice.J Neuroscience 24:6086-6097

Online Resource 4

Supplementary Figure 4: Apoptosis staining in CT26 tumors

CT-26 tumors grown in wild-type or GPR4-KO mice were stained for cleaved Caspase-3(red) and CD31 (green). Scale bar represents 50uM.

Material and Methods: see main text

Online Resource 5

Supplementary Figure 5: Pericyte staining in CT26 tumors

CT-26 tumors grown in wild-type or GPR4-KO mice were stained for a) Desmin (red) and CD31 (green); b) Smooth muscle actin (SMA; green) and CD31 (red); c) NG2 (red) and CD31 (green). Scale bar represents 50uM.

Material and Methods: see main text