Primer sequences for IGFBP2, IGFBP3, and IGFBP7methylationanalyses

Online SupplementalTable 1. Primer sequences used to analyze CpG island promoter hypermethylation of
IGFBP2, IGFBP3, and IGFBP7 in colorectal tumors.
Primer sequence
IGFBP2
Flanking primer, upstream / GTTTAGTGTYGGTTATAGGGGAAG
Flanking primer, downstream / ACTCCTAAAAAAAAATACRAATAACTC
Methylated sense strand / GAAGCGCGTAAACGAAGTTTTC
Methylated antisense strand / CGACGTAACGATAAAAAAAAACG
Unmethylated sense strand / GGGGAAGTGTGTAAATGAAGTTTTT
Unmethylated antisense strand / AAACCAACATAACAATAAAAAAAAACA
IGFBP3
Flanking primer, upstream / TTTTTTTTAATTTTTATTTTTGGG
Flanking primer, downstream / AAACAAAAAACRACTAATCCTCAAC
Methylated sense strand / TTTTTATTTTTGGGCGCGTC
Methylated antisense strand / GCCCAACCGCAATACTCG
Unmethylated sense strand / TTTTTAATTTTTATTTTTGGGTGTGTT
Unmethylated antisense strand / CTCAACACCCAACCACAATACTCA
IGFBP7
Flanking primer, upstream / TTATTATTTAGGTTAGTAAGGGTATTTG
Flanking primer, downstream / CCCATCTAACTCCTAAAATACCC
Methylated sense strand / GCGAGTAAGGTGGGTACGAGC
Methylated antisense strand / GCAATAAACAACGCGAAACG
Unmethylated sense strand / GTATTTGTGAGTAAGGTGGGTATGAGT
Unmethylated antisense strand / AAAATCACAATAAACAACACAAAACA

Sex-specific analyses (men)

Online Supplemental Table 2.Multivariable-adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for colorectal cancer by extent of IGFBP methylation in relation to body size, physical activity, and early life energy restriction in men in the Netherlands Cohort Study (1989–1993).
0 IGFBP genes methylated / 1 IGFBP gene methylated / 2 IGFBP genes methylated / 3 IGFBP genes methylated
PY / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI
Body size
Adult BMI, kg/m²
T1, sex-specific† / 3,474 / 19 / 1 / reference / 35 / 1 / reference / 31 / 1 / reference / 15 / 1 / reference
T2 / 3,404 / 19 / 0.99 / (0.52, 1.90) / 28 / 0.79 / (0.48, 1.32) / 39 / 1.28 / (0.78, 2.08) / 13 / 0.90 / (0.42, 1.92)
T3 / 3,383 / 24 / 1.31 / (0.71, 2.40) / 34 / 1.03 / (0.63, 1.69) / 55 / 1.85 / (1.17, 2.93) / 32 / 2.22 / (1.18, 4.17)
P-trend / 0.48 / 0.95 / 0.02 / 0.15
Adult BMI, per 5 kg/m² / 10,260 / 62 / 1.39 / (0.86, 2.26) / 97 / 1.17 / (0.75, 1.84) / 125 / 1.56 / (1.11, 2.21) / 60 / 1.54 / (1.01, 2.34)
BMI at age 20, kg/m²
T1, sex-specific‡ / 2,791 / 16 / 1 / reference / 27 / 1 / reference / 28 / 1 / reference / 11 / 1 / reference
T2 / 2,742 / 14 / 0.92 / (0.44, 1.92) / 28 / 1.07 / (0.62, 1.85) / 34 / 1.26 / (0.75, 2.13) / 17 / 1.57 / (0.73, 3.38)
T3 / 2,712 / 20 / 1.33 / (0.68, 2.60) / 20 / 0.79 / (0.44, 1.42) / 39 / 1.48 / (0.90, 2.43) / 15 / 1.49 / (0.68, 3.29)
P-trend / 0.58 / 0.32 / 0.41 / 0.46
BMI at age 20, per 5 kg/m² / 8,244 / 50 / 1.24 / (0.67, 2.30) / 75 / 0.93 / (0.61, 1.43) / 101 / 1.57 / (1.08, 2.28) / 43 / 1.44 / (0.74, 2.77)
BMI change, per kg/m²§
Stratum: adult BMI <25 kg/m² / 3,600 / 19 / 1.03 / (0.80, 1.34) / 28 / 0.75 / (0.60, 0.93) / 33 / 0.93 / (0.79, 1.09) / 16 / 0.98 / (0.81, 1.17)
Stratum: adult BMI ≥25 kg/m² / 3,806 / 25 / 1.01 / (0.86, 1.19) / 40 / 1.08 / (0.96, 1.20) / 59 / 0.99 / (0.88, 1.10) / 24 / 0.92 / (0.74, 1.15)
Height, cm
T1, sex-specific¶ / 3,526 / 25 / 1 / reference / 25 / 1 / reference / 39 / 1 / reference / 23 / 1 / reference
T2 / 3,450 / 21 / 0.78 / (0.43, 1.42) / 33 / 1.32 / (0.76, 2.29) / 37 / 0.84 / (0.52, 1.36) / 20 / 0.77 / (0.41, 1.44)
T3 / 3,284 / 16 / 0.55 / (0.28, 1.09) / 39 / 1.58 / (0.84, 2.98) / 49 / 0.98 / (0.59, 1.63) / 17 / 0.58 / (0.27, 1.23)
P-trend / 0.08 / 0.16 / 0.96 / 0.15
Height, per 5 cm / 10,260 / 62 / 0.85 / (0.70, 1.03) / 97 / 1.06 / (0.88, 1.28) / 125 / 0.99 / (0.84, 1.16) / 60 / 0.91 / (0.71, 1.16)
Adult trouser/skirt size
<Median, sex-specific / 3,488 / 20 / 1 / reference / 29 / 1 / reference / 34 / 1 / reference / 17 / 1 / reference
≥Median / 5,849 / 35 / 0.91 / (0.50, 1.65) / 61 / 1.17 / (0.71, 1.91) / 76 / 1.02 / (0.65, 1.60) / 34 / 0.89 / (0.46, 1.72)
Physical activity
Non-occupational, min/day
≤30 / 1,881 / 9 / 1 / reference / 10 / 1 / reference / 20 / 1 / reference / 12 / 1 / reference
>30–90 / 5,136 / 31 / 1.38 / (0.65, 2.91) / 44 / 1.70 / (0.84, 3.46) / 65 / 1.30 / (0.78, 2.18) / 37 / 1.25 / (0.64, 2.46)
>90 / 3,243 / 22 / 1.47 / (0.68, 3.19) / 43 / 2.52 / (1.23, 5.13) / 40 / 1.23 / (0.70, 2.14) / 11 / 0.56 / (0.24, 1.30)
P-trend / 0.35 / 0.01 / 0.56 / 0.09
Continues on the next page
Occupational physical activity, kJ/min
<8 kJ/min / 5,242 / 35 / 1 / reference / 60 / 1 / reference / 80 / 1 / reference / 38 / 1 / reference
8-12 / 2,373 / 14 / 0.82 / (0.44, 1.54) / 17 / 0.60 / (0.34, 1.03) / 17 / 0.43 / (0.25, 0.74) / 12 / 0.64 / (0.33, 1.25)
>12 / 1,397 / 8 / 0.79 / (0.37, 1.70) / 13 / 0.77 / (0.42, 1.41) / 17 / 0.73 / (0.42, 1.25) / 5 / 0.45 / (0.17, 1.16)
P-trend / 0.47 / 0.18 / 0.05 / 0.06
Early life energy restriction
Hunger Winter (1944–45)
Non-Western area / 3,393 / 27 / 1 / reference / 43 / 1 / reference / 65 / 1 / reference / 36 / 1 / reference
Western area / 5,069 / 24 / 1.38 / (0.78, 2.43) / 32 / 1.15 / (0.71, 1.85) / 35 / 0.83 / (0.54, 1.28) / 5 / 0.22 / (0.09, 0.58)
War Years (1940–44)
Rural area / 3,790 / 15 / 1 / reference / 37 / 1 / reference / 42 / 1 / reference / 25 / 1 / reference
Urban area / 3,829 / 32 / 2.18 / (1.13, 4.19) / 37 / 0.97 / (0.60, 1.58) / 47 / 1.14 / (0.74, 1.75) / 22 / 0.90 / (0.50, 1.62)
Economic Depression (1932–40)
Father employed / 8,719 / 56 / 1 / reference / 80 / 1 / reference / 111 / 1 / reference / 55 / 1 / reference
Father unemployed / 1,096 / 5 / 0.68 / (0.27, 1.74) / 12 / 1.17 / (0.63, 2.19) / 10 / 0.69 / (0.36, 1.34) / 3 / 0.41 / (0.13, 1.35)
Abbreviations: BMI, body mass index; IGFBP, insulin-like growth factor binding protein; PY, person-years at risk; T, tertile
* Adjusted for age. In addition, all models, except models for (non-)occupational physical activity, were adjusted for non-occupational physical activity; models for adult trouser/skirt size, (non-)occupational physical activity and early life energy restriction were adjusted for adult BMI.
† The range in tertiles of adult BMI was 16.1–23.9, 23.9–25.9 and 25.8–39.7 kg/m².
‡ The range in tertiles of BMI at age 20 was 12.0–20.8, 20.7–22.6 and 22.6–31.9 kg/m².
§ Excluding individuals with a negative BMI change since age 20. The range in BMI change was 0–12.1 kg/m² in men with an adult BMI <25 kg/m² and 0–19.1 kg/m² in men with an adult BMI ≥25 kg/m².
¶ The range in tertiles of height was 147–173, 174–179 and 180–200 cm.

Sex-specific analyses (women)

Online Supplemental Table 3.Multivariable-adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for colorectal cancer by extent of IGFBP methylation in relation to body size, physical activity, and early life energy restriction in women in the Netherlands Cohort Study (1989–1993).
0 IGFBP genes methylated / 1 IGFBP gene methylated / 2 IGFBP genes methylated / 3 IGFBP genes methylated
PY / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI / N
cases / HR* / 95% CI
Body size
Adult BMI, kg/m²
T1, sex-specific† / 3,707 / 14 / 1 / reference / 21 / 1 / reference / 22 / 1 / reference / 12 / 1 / reference
T2 / 3,655 / 15 / 1.09 / (0.52, 2.27) / 33 / 1.59 / (0.91, 2.77) / 25 / 1.14 / (0.64, 2.03) / 24 / 2.02 / (0.99, 4.10)
T3 / 3,696 / 21 / 1.49 / (0.75, 2.97) / 27 / 1.26 / (0.71, 2.25) / 32 / 1.42 / (0.82, 2.47) / 25 / 1.99 / (0.98, 4.08)
P-trend / 0.25 / 0.45 / 0.25 / 0.24
Adult BMI, per 5 kg/m² / 11,058 / 50 / 1.18 / (0.79, 1.76) / 81 / 1.20 / (0.89, 1.61) / 79 / 1.27 / (0.94, 1.72) / 61 / 1.26 / (0.97, 1.65)
BMI at age 20, kg/m²
T1, sex-specific‡ / 3,396 / 12 / 1 / reference / 22 / 1 / reference / 20 / 1 / reference / 15 / 1 / reference
T2 / 3,249 / 18 / 1.55 / (0.74, 3.27) / 27 / 1.29 / (0.73, 2.30) / 29 / 1.53 / (0.85, 2.74) / 21 / 1.49 / (0.76, 2.91)
T3 / 3,318 / 15 / 1.31 / (0.61, 2.81) / 22 / 1.05 / (0.57, 1.91) / 21 / 1.11 / (0.60, 2.06) / 18 / 1.27 / (0.64, 2.53)
P-trend / 0.68 / 0.92 / 0.87 / 0.67
BMI at age 20, per 5 kg/m² / 9,964 / 45 / 1.09 / (0.72, 1.64) / 71 / 1.20 / (0.81, 1.78) / 70 / 0.94 / (0.63, 1.40) / 54 / 1.20 / (0.81, 1.77)
BMI change, per kg/m²§
Stratum: adult BMI <25 kg/m² / 4,295 / 17 / 0.91 / (0.70, 1.17) / 34 / 0.94 / (0.77, 1.16) / 26 / 0.87 / (0.71, 1.06) / 18 / 0.78 / (0.55, 1.11)
Stratum: adult BMI ≥25 kg/m² / 4,403 / 24 / 0.98 / (0.82, 1.18) / 33 / 0.92 / (0.79, 1.09) / 38 / 1.08 / (0.97, 1.20) / 31 / 0.95 / (0.85, 1.07)
Height, cm
T1, sex-specific¶ / 4,230 / 13 / 1 / reference / 30 / 1 / reference / 21 / 1 / reference / 15 / 1 / reference
T2 / 3,811 / 21 / 1.76 / (0.85, 3.62) / 27 / 0.97 / (0.58, 1.64) / 29 / 1.44 / (0.81, 2.57) / 16 / 1.13 / (0.55, 2.30)
T3 / 3,017 / 16 / 1.65 / (0.78, 3.50) / 24 / 1.06 / (0.61, 1.84) / 29 / 1.71 / (0.95, 3.08) / 30 / 2.47 / (1.31, 4.67)
P-trend / 0.17 / 0.85 / 0.07 / 0.01
Height, per 5 cm / 11,058 / 50 / 1.08 / (0.84, 1.38) / 81 / 0.97 / (0.81, 1.16) / 79 / 1.17 / (0.96, 1.42) / 61 / 1.39 / (1.12, 1.73)
Adult trouser/skirt size
<Median, sex-specific / 4,742 / 21 / 1 / reference / 28 / 1 / reference / 23 / 1 / reference / 17 / 1 / reference
≥Median / 6,115 / 28 / 0.91 / (0.45, 1.85) / 51 / 1.36 / (0.77, 2.41) / 55 / 1.63 / (0.89, 2.98) / 44 / 1.75 / (0.90, 3.42)
Physical activity
Non-occupational, min/day
≤30 / 2,867 / 13 / 1 / reference / 23 / 1 / reference / 22 / 1 / reference / 22 / 1 / reference
>30–90 / 5,865 / 27 / 1.09 / (0.56, 2.13) / 42 / 0.96 / (0.57, 1.60) / 44 / 1.08 / (0.64, 1.81) / 28 / 0.68 / (0.38, 1.22)
>90 / 2,326 / 10 / 1.06 / (0.45, 2.46) / 16 / 0.95 / (0.49, 1.82) / 13 / 0.84 / (0.42, 1.69) / 11 / 0.71 / (0.33, 1.52)
P-trend / 0.88 / 0.86 / 0.68 / 0.32
Continues on the next page
Early life energy restriction
Hunger Winter (1944–45)
Non to Western area / 5,822 / 30 / 1 / reference / 45 / 1 / reference / 52 / 1 / reference / 37 / 1 / reference
Western area / 4,506 / 17 / 0.73 / (0.40, 1.33) / 33 / 0.95 / (0.60, 1.49) / 24 / 0.60 / (0.37, 0.98) / 21 / 0.74 / (0.43, 1.28)
War Years (1940–44)
Rural area / 3,782 / 22 / 1 / reference / 31 / 1 / reference / 38 / 1 / reference / 34 / 1 / reference
Urban area / 4,319 / 17 / 0.66 / (0.35, 1.25) / 30 / 0.82 / (0.49, 1.36) / 30 / 0.68 / (0.41, 1.13) / 16 / 0.38 / (0.21, 0.71)
Economic Depression (1932–40)
Father employed / 9,181 / 43 / 1 / reference / 67 / 1 / reference / 71 / 1 / reference / 51 / 1 / reference
Father unemployed / 1,271 / 5 / 0.78 / (0.30, 2.00) / 9 / 0.89 / (0.44, 1.81) / 5 / 0.46 / (0.18, 1.17) / 6 / 0.75 / (0.31, 1.77)
Abbreviations: BMI, body mass index; IGFBP, insulin-like growth factor binding protein; PY, person-years at risk; T, tertile
* Adjusted for age. In addition, all models, except models for non-occupational physical activity, were adjusted for non-occupational physical activity; models for adult trouser/skirt size, non-occupational physical activity and early life energy restriction were adjusted for adult BMI.
† The range in tertiles of adult BMI was 14.5–23.5, 23.4–26.2 and 26.1–41.6 kg/m².
‡ The range in tertiles of BMI at age 20 was 13.0–20.3, 20.2– 22.5 and 22.4–46.9 kg/m².
§ Excluding individuals with a negative BMI change since age 20. The range in BMI change was 0–11.5 kg/m² in women with an adult BMI <25 kg/m² and 0–22.7 kg/m² in women with an adult BMI ≥25 kg/m².
¶ The range in tertiles of height was 140–163, 164–168 and 169–186 cm.

Analyses by IGFBP2, IGFBP3, and IGFBP7 methylation status

OnlineSupplemental Table 4.Multivariable-adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for colorectal cancer by IGFBP2, IGFBP3, and IGFBP7 methylation status in relation to body size, physical activity, and early life energy restriction in the Netherlands Cohort Study (1989–1993).
IGFBP2 methylated / IGFBP2 unmethylated / IGFBP3 methylated / IGFBP3 unmethylated / IGFBP7 methylated / IGFBP7 unmethylated
PY / N
cases / HR* / (95% CI) / N
cases / HR* / (95% CI) / N
cases / HR* / (95% CI) / N
cases / HR* / (95% CI) / N
cases / HR* / (95% CI) / N
cases / HR* / (95% CI)
Body size
Adult BMI, kg/m²
T1, sex-specific† / 7,181 / 69 / 1 / reference / 110 / 1 / reference / 63 / 1 / reference / 110 / 1 / reference / 123 / 1 / reference / 55 / 1 / reference
T2 / 7,059 / 86 / 1.26 / (0.91, 1.75) / 133 / 1.22 / (0.94, 1.59) / 82 / 1.32 / (0.94, 1.85) / 116 / 1.06 / (0.81, 1.40) / 149 / 1.22 / (0.95, 1.57) / 70 / 1.28 / (0.89, 1.85)
T3 / 7,079 / 113 / 1.64 / (1.20, 2.24) / 150 / 1.38 / (1.06, 1.78) / 109 / 1.73 / (1.25, 2.39) / 149 / 1.38 / (1.06, 1.79) / 195 / 1.59 / (1.25, 2.03) / 64 / 1.19 / (0.82, 1.71)
P-trend / 0.002 / 0.02 / 0.001 / 0.02 / <0.001 / 0.36
Adult BMI, per 5 kg/m² / 21,319 / 268 / 1.25 / (1.05, 1.50) / 393 / 1.29 / (1.09, 1.53) / 254 / 1.28 / (1.06, 1.55) / 375 / 1.31 / (1.11, 1.55) / 467 / 1.37 / (1.18, 1.58) / 189 / 1.09 / (0.85, 1.39)
BMI at age 20, kg/m²
T1, sex-specific‡ / 6,187 / 62 / 1 / reference / 102 / 1 / reference / 65 / 1 / reference / 91 / 1 / reference / 113 / 1 / reference / 50 / 1 / reference
T2 / 5,991 / 93 / 1.57 / (1.13, 2.19) / 107 / 1.10 / (0.83, 1.46) / 71 / 1.14 / (0.81, 1.62) / 122 / 1.40 / (1.05, 1.86) / 146 / 1.35 / (1.04, 1.75) / 53 / 1.11 / (0.74, 1.65)
T3 / 6,029 / 65 / 1.11 / (0.78, 1.59) / 119 / 1.23 / (0.93, 1.62) / 76 / 1.25 / (0.89, 1.75) / 98 / 1.13 / (0.84, 1.53) / 124 / 1.16 / (0.89, 1.51) / 57 / 1.21 / (0.82, 1.79)
P-trend / 0.53 / 0.14 / 0.20 / 0.39 / 0.27 / 0.33
BMI at age 20, per 5 kg/m² / 18,208 / 220 / 1.13 / (0.90, 1.42) / 328 / 1.20 / (0.98, 1.47) / 212 / 1.20 / (0.93, 1.54) / 311 / 1.14 / (0.94, 1.40) / 383 / 1.19 / (0.99, 1.43) / 160 / 1.12 / (0.85, 1.48)
BMI change, per kg/m²§
Stratum: adult BMI <25 kg/m² / 7,895 / 82 / 0.88 / (0.79, 0.98) / 127 / 0.93 / (0.84, 1.03) / 77 / 0.93 / (0.83, 1.05) / 117 / 0.88 / (0.78, 0.98) / 144 / 0.88 / (0.80, 0.97) / 65 / 0.95 / (0.83, 1.09)
Stratum: adult BMI ≥25 kg/m² / 8,209 / 119 / 0.99 / (0.93, 1.06) / 173 / 1.00 / (0.93, 1.07) / 115 / 0.97 / (0.89, 1.05) / 169 / 1.02 / (0.96, 1.09) / 213 / 1.00 / (0.95, 1.06) / 76 / 0.96 / (0.87, 1.06)
Height, cm
T1, sex-specific¶ / 7,756 / 83 / 1 / reference / 127 / 1 / reference / 76 / 1 / reference / 121 / 1 / reference / 144 / 1 / reference / 64 / 1 / reference
T2 / 7,261 / 86 / 1.03 / (0.76, 1.41) / 128 / 1.01 / (0.77, 1.31) / 75 / 0.97 / (0.70, 1.36) / 132 / 1.08 / (0.83, 1.41) / 147 / 0.99 / (0.78, 1.27) / 67 / 1.11 / (0.78, 1.58)
T3 / 6,301 / 99 / 1.25 / (0.91, 1.72) / 138 / 1.14 / (0.86, 1.51) / 103 / 1.38 / (0.98, 1.95) / 122 / 1.05 / (0.79, 1.38) / 176 / 1.21 / (0.94, 1.57) / 58 / 1.08 / (0.73, 1.58)
P-trend / 0.18 / 0.36 / 0.06 / 0.74 / 0.14 / 0.69
Height, per 5 cm / 21,319 / 268 / 1.08 / (0.97, 1.20) / 393 / 1.01 / (0.92, 1.10) / 254 / 1.12 / (1.00, 1.26) / 375 / 0.97 / (0.89, 1.06) / 467 / 1.04 / (0.96, 1.13) / 189 / 1.01 / (0.90, 1.14)
Adult trouser/skirt size
<Median, sex-specific / 8,230 / 86 / 1 / reference / 119 / 1 / reference / 70 / 1 / reference / 123 / 1 / reference / 128 / 1 / reference / 76 / 1 / reference
≥Median / 11,964 / 160 / 1.02 / (0.75, 1.39) / 252 / 1.26 / (0.96, 1.65) / 166 / 1.42 / (1.01, 2.00) / 227 / 1.02 / (0.79, 1.32) / 306 / 1.32 / (1.03, 1.70) / 101 / 0.84 / (0.59, 1.20)
Physical activity
Non-occupational, min/day
≤30 / 4,747 / 64 / 1 / reference / 84 / 1 / reference / 61 / 1 / reference / 74 / 1 / reference / 108 / 1 / reference / 36 / 1 / reference
>30–90 / 11,002 / 143 / 1.02 / (0.75, 1.40) / 196 / 1.07 / (0.82, 1.40) / 138 / 1.05 / (0.77, 1.43) / 188 / 1.16 / (0.87, 1.54) / 237 / 1.01 / (0.79, 1.28) / 101 / 1.28 / (0.87, 1.89)
>90 / 5,569 / 61 / 0.82 / (0.57, 1.19) / 113 / 1.16 / (0.86, 1.56) / 55 / 0.79 / (0.54, 1.15) / 113 / 1.31 / (0.96, 1.78) / 122 / 0.97 / (0.74, 1.29) / 52 / 1.25 / (0.81, 1.92)
P-trend / 0.28 / 0.32 / 0.19 / 0.09 / 0.85 / 0.33
Early life energy restriction
Hunger Winter (1944–45)
Non-Western area / 10,891 / 157 / 1 / reference / 201 / 1 / reference / 150 / 1 / reference / 194 / 1 / reference / 251 / 1 / reference / 103 / 1 / reference
Western area / 7,899 / 70 / 0.63 / (0.47, 0.84) / 137 / 0.96 / (0.76, 1.21) / 64 / 0.60 / (0.44, 0.81) / 130 / 0.95 / (0.75, 1.20) / 143 / 0.81 / (0.65, 1.01) / 64 / 0.87 / (0.63, 1.20)
War Years (1940–44)
Rural area / 7,572 / 125 / 1 / reference / 140 / 1 / reference / 110 / 1 / reference / 144 / 1 / reference / 194 / 1 / reference / 69 / 1 / reference
Urban area / 8,148 / 88 / 0.65 / (0.49, 0.86) / 159 / 1.04 / (0.82, 1.33) / 83 / 0.69 / (0.51, 0.93) / 150 / 0.96 / (0.75, 1.22) / 176 / 0.84 / (0.67, 1.05) / 71 / 0.93 / (0.66, 1.31)
Continues on the next page
Economic Depression (1932–40)
Father employed / 17,900 / 236 / 1 / reference / 336 / 1 / reference / 225 / 1 / reference / 321 / 1 / reference / 400 / 1 / reference / 166 / 1 / reference
Father unemployed / 2,367 / 20 / 0.61 / (0.38, 0.97) / 41 / 0.88 / (0.62, 1.23) / 19 / 0.60 / (0.37, 0.97) / 38 / 0.86 / (0.60, 1.22) / 44 / 0.79 / (0.57, 1.09) / 18 / 0.78 / (0.47, 1.29)
Abbreviations: BMI, body mass index; IGFBP, insulin-like growth factor binding protein; PY, person-years at risk; T, tertile
* Adjusted for age and sex. In addition, all models, except models for non-occupational physical activity, were adjusted for non-occupational physical activity; models for adult trouser/skirt size, non-occupational physical activity and early life energy restriction were adjusted for adult BMI; models for height were adjusted for adult weight.
† The range in sex-specific tertiles of adult BMI was 16.1–23.9, 23.9–25.9 and 25.8–39.7 kg/m² in men and 14.5–23.5, 23.4–26.2 and 26.1–41.6 kg/m² in women.
‡ The range in sex-specific tertiles of BMI at age 20 was 12.0–20.8, 20.7–22.6 and 22.6–31.9 kg/m² in men and 13.0–20.3, 20.2–22.5 and 22.4–46.9 kg/m² in women.
§ Excluding individuals with a negative BMI change since age 20. The range in BMI change was 0–12.1 and 0–11.5 kg/m² in men and women, respectively, with an adult BMI <25 kg/m², and 0–19.1 and 0–22.7 kg/m² in men and women, respectively, with an adult BMI ≥25 kg/m².
¶ The range in sex-specific tertiles of height was 147–173, 174–179 and 180–200 cm in men and 140–163, 164–168 and 169–186 cm in women.