Physiological and Transcriptional Responses of Nitrosomonas Europaea to Tio2and

Title Page

Physiological and transcriptional responses of Nitrosomonas europaea to TiO2and ZnOnanoparticles and their mixtures

Ran Yu1*, Junkang Wu1, Meiting Liu1,Lianghui Chen1, Guangcan Zhu1, Huijie Lu2

1Department of Environmental Science and Engineering, School of Energy and Environment, Wuxi Engineering Research Center of Taihu Lake Water Environment, Southeast University, Nanjing, 210096, China

2Department of Civil and Environmental Engineering, University of Vermont, Burlington, VT 05405. U.S.A.

*Corresponding author:

Ran Yu, Department of Environmental Science and Engineering, School of Energy and Environment, Southeast University, No.2Sipailou Street, Nanjing, 210096, China. Phone: (+86) 15312083786; Fax: (+86) 25 83792614; email:

Supplementary Information

Tab. S1. The oligonucleotide primers of selected genes for qRT-PCR quantification.

Target Gene / Primer Sequence / Length (bp)
16S rRNA / F:5’ CGTGTCGTGAGATGTTGGGT 3’
R:5’ CGTGCTTTCTGAGATTGGC3’ / 224
amoA1 / F:5’ TCCTACGGGAGGCAGCAGT 3’
R:5’ GTGCCTTCTACAACGATTGG 3’ / 135
CphA / F:5’CAACTCGCTTACGATGTGC3’
R:5’CGATTTGGTCAGTTCCTTG3’ / 255
SucA / F:5’GCTTTACCCGTTTCCTCAC3’
R:5’CCTGGTTGCCTGGCTCTT3’ / 98

1

Tab. S2. Fifty most significantly regulated transcripts in N. europaea exposed to 10 mg/L n-ZnO (compared to the control)

Locus / Gene / P value / Fold-change / Product / Gene ontology - processes
Fold Chang: > 10 (16 genes)
UP-regulation ( 1 gene)
NE2292 / yxiE / 8.89E-10 / 11.15 / Universal stress protein / Signal transduction, stress
Down-regulation ( 15 genes)
NE0922 / cphA / 1.70E-04 / 38.83 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE0923 / 9.30E-10 / 19.90 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE0919 / 9.00E-09 / 17.97 / ABC transporter ATP-binding protein/permease / Defense mechanisms, ABC transpoter, ATP binding
NE1858 / 2.10E-08 / 16.62 / Hypothetical protein / Signal transduction
NE0345 / 6.46E-08 / 15.87 / Acriflavin resistance protein:heavy metal efflux pump CzcA / Inorganicion transport and metabolism, heavy metal transport
NE2281 / rfe / 2.57E-08 / 15.40 / Glycosyl transferase family protein / Cell membrane biogenesis, glycosyl transferase family protein
NE1757 / 3.97E-08 / 14.14 / Hypothetical protein / Cell envelope biogenesis, outer membrane, lipid A core -O-antigen ligase and related enzymes
NE0169 / acrA / 1.07E-07 / 13.17 / Hemolysin D / Cell membrane biogenesis, membrane fusion protein, signature module, chromosom partitioning protein, divisome proteins
NE0170 / oprM / 2.40E-09 / 12.87 / Outer membrane efflux protein / Intracellular traffickin, transport, efflux pump MexJK-OprM
NE1832 / 2.70E-08 / 12.51 / Hypothetical protein / Cell membrane biogenesis, outer membrane lipoprotein
NE2230 / 1.06E-08 / 10.76 / Hypothetical protein / Cell cycle control or cell division
NE1897 / 3.18E-08 / 10.58 / M48 family peptidase / Putative Zn-dependent protease
NE0927 / pan1 / 3.29E-08 / 10.50 / Multicopper oxidase type 1 / Secondary metabolism, putative multicopper oxidases, inducible nitrite reductase
NE0059 / 2.56E-06 / 10.22 / HPr kinase/phosphorylase / Signal transduction, phosphorylation catalyze
NE2330 / 9.91E-08 / 10.18 / Hypothetical protein / Signal transduction
Fold Chang: 6 ~ 10 (27 genes)
UP-regulation (4 genes)
NE0315 / mnxG / 3.13E-07 / 7.37 / Multicopper oxidase / General function prediction, related to Mn/Fe/Cu uptake or stress
NE1479 / recN / 4.57E-08 / 7.20 / DNA repair protein RecN / DNA recombination and repair, double strand breaks repair
NE1923 / cheY / 5.88E-09 / 6.84 / Response regulator receiver domain-containing protein / Signal transduction, chemotaxis family, two-component system
NE0943 / amoB1 / 7.71E-06 / 6.17 / Ammonia monooxygenase, 43 kDa subunit / Energy production and conversion, nitrogen metabolism
Down-regulation (23 genes)
NE2095 / 3.58E-08 / 9.85 / Hypothetical protein / Predicted HerA helicase, repair
NE2422 / nrdB / 1.35E-07 / 9.76 / Ribonucleotide-diphosphate reductase subunit beta / Nucleotide metabolism, purine and pyrimidine metabolism, catalyzes the rate-limiting step in dNTP synthesis
NE1899 / 6.44E-07 / 9.54 / ABC transporter ATPase / Defense mechanism, Putative ABC transporter,ABC-2 type
NE0757 / cobN / 1.63E-08 / 9.52 / Cobaltochelatase subunit CobN / Coenzyme transport and metabolism, metabolism of cofactors and vitamins, forming coordination complexes
NE0764 / ccmA / 4.13E-08 / 9.25 / Cytochrome c biogenesis protein CcmA / Posttranslational modification, ATP-binding protein, required for proper cytochrome c maturation
NE2374 / sucA / 2.93E-08 / 9.14 / 2-oxoglutarate dehydrogenase E1 component / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE1214 / ss2 / 2.17E-09 / 8.56 / Sucrose synthase:glycosyl transferase group 1 / Cell membrane biogenesis, starch and sucrose metabolism, glycosyltransferases
NE2375 / sucB / 2.92E-06 / 8.46 / Dihydrolipoamide succinyltransferase protein / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE1971 / fmt / 2.98E-07 / 8.42 / Formyl transferase N-terminus: methionyl-tRNA formyltransferase / Genetic information processing, translation, transferases
NE1701 / 2.87E-08 / 8.38 / msrA, pms; peptide methionine sulfoxide reductase / Energy production and conversion, oxidordeuctase
NE0770 / ccmH / 4.95E-08 / 8.06 / Cytochrome C-type biogenesis protein / Protein turnover, cytochrome c biogenesis protein
NE1213 / sps / 9.59E-08 / 8.00 / Group 1 glycosyl transferase / Cell membrane biogenesis, starch and sucrose metabolism
NE1733 / clpA / 1.29E-06 / 7.85 / ATP dependent protease, chaperonin / Protein turnover, folding catalyst
NE0769 / ccmG / 1.82E-07 / 7.27 / Periplasmic protein thiol: disulfide oxidoreductase DsbE / Protein turnover/Energy production and conversion, protein disulfide isomerase
NE0772 / bcp / 3.05E-07 / 7.07 / Bacterioferritin comigratory protein / Posttranslational modification, protein turnover
NE1824 / pth / 7.43E-06 / 7.02 / Peptidyl-tRNA hydrolase / Translation, carboxylic-ester hydrolases
NE0763 / truB / 3.20E-05 / 6.96 / tRNA pseudouridine synthase B / Translation, ribosomal structure and biogenesis, somerase
NE0608 / gcvH1 / 1.30E-08 / 6.65 / Glycine cleavage system protein H / Amino acid metabolism; glycine, serine and threonine metabolism
NE1947 / yjeP / 5.85E-06 / 6.59 / Hypothetical protein / Celluar membrane biogenesis, potassium efflux system protein
NE1329 / glnE / 1.78E-08 / 6.52 / Bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase / Posttranslational modification/Signal transduction, glutamate-ammonia-ligase adenylyltransferase
NE0909 / speC / 3.05E-06 / 6.43 / Orn/DAP/Arg decarboxylase family protein / Amino acid metabolism, arginine and proline metabolism
ptsN / 8.32E-07 / 6.25 / Phosphotransferase system mannitol IIA domain-containing protein / Signal transduction/Carbohydrate transport and metabolism, phosphotransferase system (PTS), membrane transport
NE0771 / cycH / 8.74E-08 / 6.20 / Hypothetical protein / Protein turnover, cytochrome c biogenesis factor
Fold Chang: 4~6 (7 genes)
Up-regulation (4 genes)
NE0613 / apaH / 2.46E-10 / 5.74 / Diadenosine tetraphosphatase / Signal transduction, ADP forming
NE0983 / mraW / 2.94E-06 / 5.54 / S-adenosyl-methyltransferase MraW / Cell envelope biogenesis, methyltransferase
NE1805 / wza / 1.17E-08 / 5.48 / Polysaccharide export protein, outer membrane / Cell envelope biogenesis, outer membrane, polysaccharide export protein, ABC transporters
NE1785 / pt / 8.23E-07 / 5.48 / Phosphotyrosine protein phosphatase / Signal transduction, phosphoric-monoester hydrolases
Down-regulation (3 genes)
NE0767 / ccmE / 4.38E-09 / 5.87 / Cytochrome c-type biogenesis protein CcmE / Posttranslational modification, cytochrome c maturation system
NE0153 / engA / 9.01E-06 / 5.84 / GTP-binding protein EngA / General function prediction only, ribosome biogenesis
NE1548 / fadE / 1.82E-07 / 5.83 / Acyl-CoA dehydrogenase / Lipid metabolism, functions in fatty acid oxidation

Tab. S3. Fifty most significantly regulated transcripts in N. europaea exposed to 50 mg/L n-TiO2 (compared to the control)

Locus_tag / Gene / P value / Fold-change / Product / Gene ontology - processes
Fold Chang: > 10 (21 genes)
Down-regulation ( 21 genes)
NE0922 / cphA / 2.03E-04 / 33.05 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE0923 / 1.10E-07 / 30.39 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE2153 / 2.58E-08 / 26.76 / Hypothetical protein / Transcription, transcriptional regulator
NE0927 / pan1 / 6.03E-08 / 24.46 / Multicopper oxidase type 1 / Secondary metabolism, putative multicopper oxidases, inducible nitrite reductase
NE1858 / 1.64E-08 / 18.35 / Hypothetical protein / Signal transduction
NE0757 / cobN / 2.54E-06 / 18.09 / Cobaltochelatase subunit CobN / Coenzyme transport and metabolism, metabolism of cofactors and vitamins, forming coordination complexes
NE0345 / 5.02E-06 / 16.63 / Acriflavin resistance protein:heavy metal efflux pump CzcA / Inorganic ion transport and metabolism, heavy metal transport
NE0919 / 3.07E-09 / 16.52 / ABC transporter ATP-binding protein/permease / Defense mechanisms, ABC transpoter, ATP binding
NE2230 / 1.20E-08 / 13.53 / Hypothetical protein / Cell cycle control or cell division
NE1832 / 4.45E-08 / 12.79 / Hypothetical protein / Cell membrane biogenesis, outer membrane lipoprotein
NE0925 / 2.94E-08 / 12.26 / Cytochrome c, class IC:cytochrome c, class I / Energy production and conversion/Signal transduction, oxidative phosphorylation,
NE0764 / ccmA / 1.17E-08 / 11.93 / Cytochrome c biogenesis protein CcmA / Posttranslational modification, ATP-binding protein, required for proper cytochrome c maturation
NE2544 / 6.46E-06 / 11.81 / Helix-hairpin-helix DNA-binding motif-containing protein / Transcription
NE2422 / nrdB / 2.13E-07 / 11.79 / Ribonucleotide-diphosphate reductase subunit beta / Nucleotide metabolism, purine and pyrimidine metabolism, catalyzes the rate-limiting step in dNTP synthesis
NE1604 / 7.24E-06 / 10.81 / General (type II) secretion pathway (GSP) D protein / Intracellular trafficking, secretion, and transport, type II secretion system
NE1757 / 2.46E-07 / 10.49 / Hypothetical protein / Cell envelope biogenesis, outer membrane, lipid A core -O-antigen ligase and related enzymes
NE1837 / 7.76E-09 / 10.43 / Chorismate--pyruvate lyase / Ubiquinone and other terpenoid-quinone biosynthesis, chorismate lyase
NE1897 / 7.79E-07 / 10.35 / M48 family peptidase / Putative Zn-dependent protease
NE0336 / hisC2 / 9.06E-08 / 10.34 / Histidinol-phosphate aminotransferase / Amino acid metabolism, formation of L-histidinol phosphate from imidazole-acetol phosphate and glutamate
NE1600 / 8.48E-08 / 10.19 / Hypothetical protein / Cell motility and secretion/intracellular trafficking and secretionpilus, assembly protein
NE0336 / hisC2 / 9.06E-08 / 10.34 / Histidinol-phosphate aminotransferase / Amino acid metabolism, formation of L-histidinol phosphate from imidazole-acetol phosphate and glutamate
Fold Chang: 6 ~ 10 (29 genes)
UP-regulation (5 genes)
NE1923 / cheY / 1.05E-08 / 8.20 / Response regulator receiver domain-containing protein / Signal transduction, chemotaxis family, two-component system
NE1805 / wza / 2.15E-05 / 7.56 / Polysaccharide export protein, outer membrane / Cell envelope biogenesis, outer membrane, polysaccharide export protein, ABC transporters
NE1436 / metE / 3.69E-08 / 7.30 / Five-methyltetrahydropteroyltriglutamate/ Homocysteine S-methyltransferase / Amino acid metabolism, cysteine and methionine metabolism, transferases
NE0315 / mnxG / 1.69E-08 / 6.86 / Multicopper oxidase / General function prediction, related to Mn/Fe/Cu uptake or stress
NE0943 / amoB1 / 9.08E-07 / 6.80 / Ammonia monooxygenase, 43 kDa subunit / Energy production and conversion, nitrogen metabolism
Down-regulation (24 genes)
NE0924 / aniA / 1.94E-07 / 9.99 / Multicopper oxidase type 1 / Secondary metabolites biosynthesis, cupredoxin domain 1 of copper-containing nitrite reductase
NE0926 / 2.46E-07 / 9.81 / Cytochrome c, class I / Energy production and conversion, electron-transport
NE2375 / sucB / 2.78E-06 / 9.45 / Dihydrolipoamide succinyltransferase protein / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE0170 / oprM / 1.45E-07 / 9.36 / Outer membrane efflux protein / Cell membrane biogenesis, intracellular traffickin, transport, efflux pump MexJK-OprM
NE2374 / sucA / 2.40E-08 / 9.24 / Two-oxoglutarate dehydrogenase E1 component / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE0011 / cyp / 5.06E-06 / 8.74 / Cytochrome P460 / Energy production and conversion, electron-transport
NE0169 / acrA / 6.05E-06 / 8.73 / Hemolysin D / Cell membrane biogenesis, membrane fusion protein, signature module, chromosom partitioning protein, divisome proteins
NE1603 / 2.54E-06 / 8.37 / General secretion pathway gspG related transmembrane protein / Cell motility and secretion/intracellular trafficking and secretion, type II secretory pathway, membrane transport
NE1602 / 7.15E-07 / 8.17 / General secretion pathway protein G / Intracellular trafficking and secretion, protein export
NE1762 / hptG / 9.53E-08 / 8.16 / Heat shock protein 90 / Protein turnover, molecular chaperone, phosphoprotein phosphatases (PPPs)
NE0608 / gcvH1 / 5.40E-08 / 8.08 / Glycine cleavage system protein H / Amino acid metabolism; glycine, serine and threonine metabolism
NE0882 / surA / 1.03E-07 / 8.08 / PpiC-type peptidyl-prolyl cis-trans isomerase / Protein turnover, protein folding catalyst
NE0134 / 7.73E-07 / 8.03 / Transposase / DNA replication or recombination, transposase and inactivated derivatives
NE1950 / grpE / 3.00E-05 / 7.69 / Heat shock protein GrpE / Molecular chaperone , thermosensor
NE0883 / pdxA / 1.16E-07 / 7.61 / Four-hydroxythreonine-4-phosphate dehydrogenase / Coenzyme metabolism, metabolism of cofactors and vitamins, oxidoreductases
NE1214 / ss2 / 1.35E-07 / 7.56 / Sucrose synthase:glycosyl transferase group 1 / Cell membrane biogenesis, starch and sucrose metabolism, glycosyltransferases
NE0465 / fliL / 3.02E-08 / 7.12 / Flagellar basal body-associated protein FliL / Cell motility
NE2281 / rfe / 9.91E-08 / 6.79 / Glycosyl transferase family protein / Cell membrane biogenesis, glycosyl transferase family protein
NE0767 / ccmE / 1.99E-07 / 6.52 / Cytochrome c-type biogenesis protein CcmE / Posttranslational modification, cytochrome c maturation system
NE1848 / greB / 6.97E-07 / 6.25 / Transcription elongation factor GreB / Transcription
NE1865 / cheW / 2.08E-07 / 6.22 / Chemotaxis protein CheW / Cell motility/signal transduction mechanisms, Two-component system, bacterial chemotaxis
NE2423 / nrdA / 1.03E-06 / 6.16 / Ribonucleotide-diphosphate reductase subunit alpha / Nucleotide metabolism, oxidoreductases, catalyzes the rate-limiting step in dNTP synthesis
NE0909 / speC / 5.41E-06 / 6.13 / Orn/DAP/Arg decarboxylase family protein / Amino acid metabolism, arginine and proline metabolism
NE1213 / sps / 1.07E-06 / 5.72 / group 1 glycosyl transferase / Cell membrane biogenesis, Starch and sucrose metabolism,Glycosyltransferases

Tab. S4. Fifty most significantly regulated transcripts in N. europaea exposed to NP mixture (compared to the control)

Locus_tag / Gene / P value / Fold-change / Product / Gene ontology - processes
Fold Chang: > 10 (17 genes)
Down-regulation ( 17 genes)
NE0922 / cphA / 2.94E-04 / 24.12 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE0923 / 7.34E-10 / 22.54 / Cyanophycin synthetase / Cell membrane biogenesis, forming carbon-nitrogen bonds, ADP-forming, temporary nitrogen store
NE0919 / 1.61E-07 / 17.80 / ATP-binding protein/permease / Defense mechanisms, ABC transpoter, ATP binding
NE0345 / 3.50E-08 / 16.54 / Acriflavin resistance protein:heavy metal
efflux pump CzcA / Inorganic ion transport and metabolism, heavy metal transport
NE0757 / cobN / 2.50E-06 / 12.80 / Cobaltochelatase subunit CobN / Coenzyme transport and metabolism, metabolism of cofactors and vitamins, forming coordination complexes
NE0358 / 3.00E-07 / 12.38 / Hypothetical protein / Ribosome biogenesis
NE2439 / 1.40E-09 / 11.53 / Hypothetical protein / Function unknown
NE1410 / 1.34E-07 / 11.48 / Hypothetical protein / Function unknown
NE1897 / 2.02E-06 / 11.39 / M48 family peptidase / Putative Zn-dependent protease
NE2544 / 2.49E-10 / 11.33 / Helix-hairpin-helix DNA-binding motif-containing protein / Transcription
NE1832 / 5.61E-07 / 11.24 / Hypothetical protein / Cell membrane biogenesis, outer membrane lipoprotein
NE1604 / 4.39E-08 / 10.93 / General secretion pathway D protein / Intracellular trafficking, secretion, and transport, type II secretion
NE0764 / ccmA / 1.53E-08 / 10.76 / Cytochrome c biogenesis protein CcmA / Posttranslational modification, ATP-binding protein, required for proper cytochrome c maturation
NE1837 / 2.21E-06 / 10.50 / Chorismate--pyruvate lyase / Ubiquinone and other terpenoid-quinone biosynthesis, chorismate lyase
NE0898 / 3.58E-05 / 10.41 / Hypothetical protein / Function unknown
NE1538 / 2.62E-05 / 10.07 / Hypothetical protein / Cell cycle control
NE2281 / rfe / 4.32E-08 / 10.02 / Glycosyl transferase family protein / Cell membrane biogenesis, glycosyl transferase family protein
Fold Chang: 6 ~ 10 (33 genes)
UP-regulation (4 genes)
NE1923 / cheY / 8.29E-09 / 8.42 / Response regulator receiver domain-containing protein / Signal transduction, chemotaxis family, two-component system
NE2038 / 4.46E-07 / 7.17 / Myeloperoxidase thyroid peroxidase cyclooxygenase catalytic subunit / General function prediction only, peroxidase
NE0943 / amoB1 / 9.08E-07 / 6.80 / Ammonia monooxygenase, 43 kDa subunit / Energy production and conversion, nitrogen metabolism
NE0315 / mnxG / 8.67E-08 / 6.62 / Multicopper oxidase / General function prediction, related to Mn/Fe/Cu uptake or
stress
Down-regulation (29 genes)
NE2422 / nrdB / 5.97E-08 / 9.89 / Ribonucleotide-diphosphate reductase subunit beta / Nucleotide metabolism, purine and pyrimidine metabolism, catalyzes the rate-limiting step in dNTP synthesis
NE2231 / 4.85E-07 / 9.82 / Hypothetical protein / General function prediction only, transferase
NE1757 / 1.32E-08 / 9.65 / Hypothetical protein / Cell envelope biogenesis, outer membrane, lipid A core -O-antigen ligase and related enzymes
NE2375 / sucB / 2.22E-06 / 9.31 / Dihydrolipoamide succinyltransferase protein / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE2374 / sucA / 6.30E-08 / 9.01 / 2-oxoglutarate dehydrogenase E1 component / Energy production and conversion, carbohydrate metabolism, TCA cycle
NE0170 / oprM / 4.34E-07 / 8.94 / Outer membrane efflux protein / Intracellular traffickin, transport, efflux pump MexJK-OprM
NE1899 / 1.65E-05 / 8.71 / ABC transporter ATPase / Coenzyme transport and metabolism, metabolism of cofactors and vitamins, forming coordination complexes
NE1602 / 6.60E-07 / 8.60 / General secretion pathway protein G / Intracellular trafficking and secretion, protein export
NE1214 / ss2 / 2.82E-06 / 8.43 / Sucrose synthase:glycosyl transferase group 1 / Cell membrane biogenesis, starch and sucrose metabolism, glycosyltransferases
NE0492 / 5.70E-08 / 8.31 / transposase / Function unknown
NE0231 / 8.45E-06 / 8.31 / Hypothetical protein / Replication, recombination and repair
NE1900 / 3.28E-06 / 8.21 / Hypothetical protein / Defense mechanisms, putative ABC transport system permease protein
NE1603 / 4.85E-08 / 8.09 / General secretion pathway gspG related transmembrane protein / Cell motility and secretion/intracellular trafficking and secretion, type II secretory pathway, membrane transport
NE0169 / acrA / 6.42E-05 / 8.08 / Hemolysin D / Cell membrane biogenesis, membrane fusion protein, signature module, chromosom partitioning protein, divisome proteins
NE2095 / 4.24E-07 / 7.84 / Hypothetical protein / Predicted HerA helicase, repair
NE0882 / surA / 1.23E-08 / 7.83 / PpiC-type peptidyl-prolyl cis-trans isomerase / Protein turnover, protein folding catalyst
NE0217 / tolA / 2.29E-04 / 7.54 / Hypothetical protein / Cell membrane biogenesis, colicin import membrane protein
NE0883 / pdxA / 6.44E-08 / 7.47 / 4-hydroxythreonine-4-phosphate dehydrogenase / Coenzyme metabolism, metabolism of cofactors and vitamins, oxidoreductases
NE0011 / cyp / 3.35E-06 / 7.35 / Hytochrome P460 / Energy production and conversion, electron-transport
NE1600 / 1.02E-07 / 7.27 / Hypothetical protein / Cell motility and secretion/intracellular trafficking and secretionpilus, assembly protein
NE0357 / 6.30E-08 / 7.25 / rRNA large subunit methyltransferase / Ribosome biogenesis, rRNA (pseudouridine1915-N3)-methyltransferase
NE0608 / gcvH1 / 6.66E-08 / 7.22 / Glycine cleavage system protein H / Amino acid metabolism; glycine, serine and threonine metabolism
NE0909 / speC / 1.26E-05 / 7.14 / Orn/DAP/Arg decarboxylase family protein / Amino acid metabolism, arginine and proline metabolism
NE1698 / 4.04E-07 / 6.99 / Hypothetical protein / Replication, recombination or repair
NE1163 / 8.14E-08 / 6.99 / GTP cyclohydrolase / Metabolism of cofactors and vitamins, folate biosynthesis, acting on carbon-nitrogen bonds
NE0134 / 4.81E-07 / 6.93 / Transposase / DNA replication or recombination, transposase and inactivated derivatives
NE0670 / 1.48E-05 / 6.79 / Membrane fusion protein MtrC / Cell membrane biogenesis
NE1806 / 2.29E-06 / 6.72 / ABC transporter ATP-binding protein / ABC transport system, sulfate-transporting ATPase, acting on acid anhydrides to catalyse transmembrane movement,
NE1865 / cheW / 1.69E-07 / 6.62 / Chemotaxis protein CheW / Cell motility/signal transduction mechanisms, Two-component system, bacterial chemotaxis

Tab. S5. The selected functional genes with significant transcriptional responses to the stresses of 10 mg/L n-ZnO, 50 mg/L n-TiO2, and their mixture

Locus_tag / Gene / Product / 10 mg/L n-ZnO / 50 mg/L n-TiO2 / NP mixture
(vs control) / (vs control) / (vs control)
R / FC / R / FC / R / FC
Thioredoxin genes
NE0084 / thioredoxin / up / 2.87 / - / - / - / -
NE1034 / trxA / thioredoxin / - / - / up / 2.42 / up / 2.19
NE1319 / thioredoxin / up / 2.46 / - / - / - / -
NE0366 / dsbA / thioredoxin:DSBA oxidoreductase / - / - / up / 2.07 / - / -
Heavy metal resistant genes
NE0839 / merA / mercuric reductase / up / 2.02 / - / - / - / -
NE0841 / merP / mercury scavenger protein / up / 2.03 / - / - / - / -
NE0843 / merR / transcriptional regulator MerR / up / 3.40 / - / - / - / -
DNA repair genes
NE1535 / DNA polymerase beta-like protein / up / 8.49 / up / 5.58 / up / 5.04
NE1479 / recN / DNA repair protein RecN / up / 7.20 / up / 3.40 / up / 3.54
Stress genes
NE2292 / yxiE / universal stress protein / up / 11.15 / up / 4.79 / up / 5.08
NE1201 / universal stress protein / up / 3.98 / up / 2.10 / up / 2.48
Ammonia oxidation genes
NE0943 / amoB1 / ammonia monooxygenase, 43 kDa subunit / up / 6.17 / up / 6.80 / up / 6.80
NE0944 / amoA1 / ammonia monooxygenase / up / 3.02 / up / 3.67 / up / 3.67
NE0945 / amoC1 / ammonia monooxygenase subunit C2 / up / 3.64 / up / 2.95 / up / 3.03
NE2064 / amoC2 / ammonia monooxygenase subunit C / up / 2.86 / up / 2.93 / up / 2.86

Note: R represents regulation, FC represents fold-change ratio

Tab. S6. The screened significantly regulated transcripts in N. europaea exposed to the mixture of n-ZnO and n-TiO2 as compared to in the individual NP impacted ones

Locus_tag / Gene / Product / 10 mg/L n-ZnO / Mixture system / 50 mg/L n-TiO2
(vs control) / (vs 10 mg/L n-ZnO) / (vs 50 mg/L n-TiO2) / (vs control)
R / FC / R / FC / R / FC / R / FC
NE2292 / yxiE / universal stress protein / up / 11.15 / down / 2.19 / - / - / up / 4.79
NE2090 / hypothetical protein / up / 7.88 / down / 2.37 / - / - / up / 3.64
NE1479 / recN / DNA repair protein RecN / up / 7.20 / down / 2.03 / - / - / up / 3.41
NE0613 / apaH / diadenosine tetraphosphatase / up / 5.74 / down / 2.28 / - / - / up / 2.61
NE0980 / RNA polymerase ECF-subfamily sigma-70 factor / up / 2.69 / down / 5.55 / down / 2.11 / - / -
NE1617 / ECF subfamily RNA polymerase sigma factor / up / 2.82 / down / 5.47 / down / 2.84 / - / -
NE0441 / leucyl aminopeptidase / up / 5.35 / down / 2.26 / - / - / up / 2.28
NE0657 / hydrolase / up / 5.23 / down / 2.28 / - / - / up / 2.38
NE2142 / hypothetical protein / up / 4.88 / down / 2.47 / - / - / up / 2.49
NE1963 / cmk / cytidylate kinase / up / 4.20 / down / 2.07 / - / - / - / -
NE1403 / uroporphyrin-III C-methyltransferase / up / 4.08 / down / 2.08 / - / - / - / -
NE0510 / hypothetical protein / up / 4.05 / up / 2.29 / - / - / up / 10.04
NE1875 / esterase/lipase/thioesterase family protein / up / 3.59 / down / 2.24 / - / - / - / -
NE0843 / merR / transcriptional regulator MerR / up / 3.40 / down / 2.02 / - / - / - / -
NE1257 / type II secretion system protein E / up / 2.24 / down / 3.04 / - / - / - / -
NE0245 / hypothetical protein / up / 3.01 / down / 2.02 / - / - / - / -
NE1992 / ECF subfamily RNA polymerase sigma factor / up / 2.24 / down / 2.96 / - / - / - / -
NE0584 / rpoH / RNA polymerase factor sigma-32 / up / 2.93 / down / 2.17 / - / - / - / -
NE0511 / hypothetical protein / up / 2.68 / down / 2.26 / - / - / - / -
NE0574 / major membrane protein I / up / 2.67 / down / 2.15 / - / - / - / -
NE1350 / hypothetical protein / up / 2.65 / down / 2.25 / - / - / - / -
NE1311 / helix-hairpin-helix DNA-binding motif-containing protein / up / 2.41 / down / 2.58 / - / - / - / -
NE2537 / sinR / helix-hairpin-helix DNA-binding motif-containing protein / up / 2.58 / down / 2.28 / - / - / - / -
NE2124 / TonB-dependent receptor protein / up / 2.31 / down / 2.44 / down / 3.26 / up / 3.08
NE0975 / hypothetical protein / up / 2.41 / down / 2.10 / - / - / - / -
NE1224 / hypothetical protein / up / 2.38 / down / 2.16 / - / - / - / -
NE0152 / PQQ repeat-containing protein / up / 2.21 / down / 2.04 / - / - / - / -
NE0927 / pan1 / multicopper oxidase type 1 / down / 10.50 / up / 3.80 / up / 8.84 / down / 24.46
NE2153 / hypothetical protein / down / 6.12 / up / 2.65 / up / 11.60 / down / 26.76
NE1519 / hypothetical protein / down / 5.82 / up / 2.09 / down / 2.52
NE0925 / cytochrome c, class IC:cytochrome c, class I / down / 4.99 / up / 2.82 / up / 6.92 / down / 12.26
NE1539 / hypothetical protein / down / 4.46 / down / 3.82 / down / 5.99 / down / 2.85
NE0926 / cytochrome c, class I / down / 4.08 / up / 2.69 / up / 6.47 / down / 9.81
NE0492 / transposase / down / 3.88 / down / 2.14 / - / - / down / 6.72
NE0924 / aniA / multicopper oxidase type 1 / down / 3.82 / up / 2.22 / up / 5.81 / down / 9.99
NE2545 / hypothetical protein / down / 3.76 / down / 3.01 / - / - / down / 10.78
NE0871 / hisG / ATP phosphoribosyltransferase catalytic subunit / down / 2.18 / up / 3.69 / - / - / - / -
NE1783 / thiF / NAD binding site:UBA/THIF-type NAD/FAD binding fold / down / 3.69 / up / 2.16 / - / - / - / -
NE1445 / nitrogen-fixing protein NifU / down / 3.38 / up / 3.65 / up / 3.79 / down / 3.51
NE1035 / rho / transcription termination factor Rho / down / 3.37 / up / 2.07 / - / - / - / -
NE1446 / NifU-like domain-containing protein / down / 2.44 / up / 2.94 / up / 4.45 / down / 3.69
NE1447 / aminotransferase class-V / down / 2.61 / up / 2.81 / up / 4.61 / down / 4.27
NE0176 / hypothetical protein / down / 2.66 / up / 2.07 / - / - / - / -
NE1448 / hypothetical protein / down / 2.05 / up / 2.60 / up / 4.83 / down / 3.81
NE0362 / folD / bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase / down / 2.54 / up / 2.23 / - / - / - / -
NE2105 / hypothetical protein / down / 2.52 / up / 2.23 / - / - / - / -
NE0197 / hypothetical protein / down / 2.11 / up / 2.36 / - / - / - / -
NE0928 / yhdE / hypothetical protein / down / 2.19 / up / 2.04 / - / - / - / -
NE1950 / grpE / heat shock protein GrpE / down / 2.15 / down / 2.12 / - / - / down / 7.69
NE1449 / ycf16 / Iron-regulated ABC transporter ATPase SufC / down / 2.07 / up / 2.08 / up / 4.79 / down / 4.76
NE1452 / hypothetical protein / - / - / up / 3.47 / up / 12.41 / down / 6.41
NE2151 / hypothetical protein / - / - / up / 2.70 / up / 11.21 / down / 8.15
NE1451 / hesB/yadR/yfhF family protein / - / - / up / 3.46 / up / 10.71 / down / 5.27
NE1436 / metE / 5- methyltetrahydropteroyltriglutamate /homocysteine S-methyltransferase / up / 2.23 / - / - / down / 3.67 / up / 7.30
NE1450 / cysteine desulfurase activator complex subunit SufB / - / - / - / - / up / 5.71 / down / 4.06
NE1538 / hypothetical protein / - / - / down / 8.08 / down / 4.82 / down / 2.09
NE2125 / fiu / hydroxylase / - / - / - / - / down / 2.01 / up / 2.02
NE1542 / hypothetical protein / down / 4.63 / - / - / down / 2.63 / down / 2.70

Note: R represents regulation, FC represents fold-change ratio