TMEM106btm1a x TMEM106btm1aGenotyping Protocol

Protocol requires two separate PCR reactions and can distinguish between TMEM106btm1a homozygous, heterozygous, and wild-type animals. Reaction #2 can identify TMEM106btm1a homozygous animals, but cannot distinguish between the TMEM106btm1a heterozygous and wild-type animals.

PCR Reaction #1:

Reagent / Volume/rxn (ul)
ddH2O / 37.7
10X PCR Buffer (Takara) / 5.0
2.5mM dNTPS (Takara) / 3.5
50 M TeTX For (ie, lacZ) / 0.2
50 M TeTX Rev (ie, lacZ) / 0.2
50 M oIMR7338 For Control / 0.1
50 M oIMR7339 Rev Control / 0.1
Taq Polymerase (Takara) / 0.25
Tail DNA / 3

PCR Program, Eppendorf Pro (Called TeTX under genotyping header)

  1. 94C for 2 minutes
  2. A. 94C for 20 seconds

B. 60C for 20 seconds

C. 72C for 1 minute

D. 40 Cycles A-C

3. 72C for 2 minutes

4. Hold at 4C

Primer Sequences:

TeTX (recognizes lacZ) For: TAT TGG CTT CAT CCA CCA CA

TeTX (recognizes lacZ) Rev: CGG ATT GAA AAT GGT CTG CT

oIMR7338 For Control (recognizes interleukin-2): CTA GGC CAC AGA ATT GAA AGA TCT

oIMR7339 Rev Control (recognizes interleukin-2): GTA GGT GGA AAT TCT AGC ATC ATC C

Expected Products: Transgenic LacZ

Transgenic animals should exhibit a 238 bp band.

Expected Products: Internal Control

All animals, transgenic and wild-type, should exhibit the 324 bp band, indicating successful amplification of the tail DNA.

Gel Percentage: 2% Agarose Gel (run at 200 V for 20 mins in 1x SB buffer)

Reference:

Jackson Laboratory PCR for LacZ

NCBI Genebank file of mouse IL-2

The Jackson Laboratory Standard PCR Protocol for Mapttm1(EGFP)Kit/J

PCR Reaction #2:

Reagent / Volume/rxn (ul)
ddH2O / 33.6
10X PCR Buffer / 5.0
25mM MgCl2 / 1.5
5mM dNTPs / 1.5
50M Primer 36 / 0.5
50M Primer 38 / 0.5
50M MAPT #1 / 0.2
50M MAPT #2 / 0.2
Taq Polymerase / 1
Tail DNA / 3

PCR Program (called Flpe PCR in SimpliAmp)

  1. 94C for 5 minutes
  2. A. 94C for 30 seconds

B. 56 C for 1 minute

C. 72C for 1 minute

D. Repeat 2A-C for 35 cycles

3. 72C for 5 min

4. Hold at 4C

Primer Sequences

MAPT #1 (oIMR3092): CTCAGCATCCCACCTGTAAC

MAPT #2 (oIMR3093): CCAGTTGTGTATGTCCACCC

Primer 36: CTGAGAACATGAGGAGTGATGAG

Primer 38: CGTTCTTCTTGGCCGTAAC

Gel Percentage: 2% Agarose Gel (run at 200 V for 20 min in 1x SB buffer)

Expected Products: Animals containing the wildtype allele should exhibit a band at 601 bp, while animals with the tm1a allele should not exhibit a band.

Expected Products: Internal Control

All animals, transgenic and wild-type, should exhibit the 187 bp band, indicating successful amplification of the tail DNA.

Reference:

The Jackson Laboratory Standard PCR Protocol for Mapttm1(EGFP)Kit/J

Overall Expected Results:

Genotype / Rxn #1 / Rxn #2
TMEM106bWT/WT / - / +
TMEM106bWT/tm1a / + / +

TMEM106btm1a/tm1a / + / -

Animals positive (+) for rxn #1 exhibits a band at 238 bp. Animals positive (+) for rxn #2 exhibits a band at 601.